Questions 9 to 13 are in reference to the DNA sequence shown in Question 8.

Here is Question 8.

Question 8:

The top strand of the following segment of DNA serves as the template strand:

3’ TACACCTTGGCGACGACT 5’

5’ ATGTGGAACCGCTGCTGA 3’

We will refer to this segment of DNA as the original (or unmutated) sequence.

Please answer the following questions:

(a) What is the mRNA sequence?

The mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.**

(b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated.

The amino acid sequence for this protein is N-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein.

i.e. input the amino acids in the order that they would be translated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with a hyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer this question.

Question 10:

The original (unmutated) DNA sequence (shown above in Question 8) has been mutated to the following (this represents the template strand):

3’ TACGACCTTGGCGACGACT 5’

We will refer to this sequence as mutation #2.

Please note that for simplicity only the template strand for this mutated segment of DNA is shown.

Answer the following questions:

(a) What is the complete mRNA sequence for the mutated segment mutation #2?

The mutated mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.**

(b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated.

The amino acid sequence for this protein is N-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein.

i.e. input the amino acids in the order that they would be translated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with a hyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer this question.

4 points   

QUESTION 11

Questions 9 to 13 are in reference to the DNA sequence shown in Question 8.

Question 11:

The original (unmutated) DNA sequence (shown above in Question 8) has been mutated to the following (this represents the template strand):

3’ TACACCTTAGCGACGACT 5’.

We will refer to this sequence as mutation #3.

Please note that for simplicity only the template strand for this mutated segment of DNA is shown.

Answer the following questions:

(a) What is the complete mRNA sequence for the mutated segment mutation #3?

The mutated mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.**

(b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated.

The amino acid sequence for this protein is N-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein.

i.e. input the amino acids in the order that they would be translated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with a hyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer this question.

4 points   

QUESTION 12

Questions 9 to 13 are in reference to the DNA sequence shown in Question 8.

Question 12:

(1 mark each)

In reference to the original sequence (shown in Question 8), classify each type of mutation present from Questions 9 to 11. Choose the best option for each.

QUESTION 13

Questions 9 to 13 are in reference to the DNA sequence shown in Question 8.

Question 13:

Most mutations have a neutral effect on the phenotype, function or survival of an organism because they do not elicit any noticeable change. Whereas other mutations can have a positive effect on an organism leading to new versions of proteins that help an organism adapt to changes in its environment; while other mutations can have a negative effect on the organism and result in a protein that does not function normally or at all.

Answer the following questions based on the responses you gave above in Questions 8 to 12.

(a) Based on the protein sequences that were produced as a result of mutation #1, mutation #2, or mutation #3, describe the effect, if any, these mutations would likely have on the function of the protein within the cell. Support your answer.

(b) If these mutations occurred within a germline cell and not a somatic cell, how would the effects of these mutations differ?

: Develop a public health policy of Malaria Emerging Diseases

A plant cell that contains 80% water in the cytoplasm has been flooded with 40% saltwater. What process will occur that will impact the size/weight of the cell?

Select one:

a. Diffusion of salt in the cell

b. Osmosis

c. Diffusion of salt out of the cell

d. Dynamic equilibrium

e. none are correct

explain each of these symptoms seprately

1-painful urination

2-thick,bloody discharge from male and female sex organs

3-burning sensation during urination

4-lower abdominal pain

5-abnormal bleeding in women

6-testicular pain in men

7-pain during intercourse

8-itching

9-painful bowl movement

10-heavy menstural bleeding

explain each of them clearly.

1. the reaction for photosynthesis is like the mirror image of another reaction called

A) ATP hydrolysis

B) redox reaction

C) phosphorylation

D) cellular respiration

2. Photosynthesis consists of which two set of reactions that are linked by redox reactions to generate chemical energy

A) light capturing reactions and splitting water  

B) light capturing reactions and chemiosmosis

C) light capturing reactions and Kelvin cycle

D) light capturing reactions and oxidative phosphorylation

3. The photosynthetic pigments of plant are located in or at the

A) cellular cytoplasm

B) thylakoid membrane

C) stroma

D) apoplast  

4. To date, in all of biology, only Photosystem II is known to use solar energy to

A) provide highly energetic electrons to redox reactions that generate chemical energy

B) to provide energy for chemiosmosis

C) absorb light of a wavelength between 550 and 600 nm

D)  produce oxygen by oxidizing (or splitting) water.

5. Rubisco is

A) the enzyme that fixes CO₂ to RuBP

B) a slow enzyme

C) an enzyme that can catalyze two different reactions

D)  All of the above

14) Using the following findings of volume flow and osmolarity throughout a nephron, describe andfully explain the processes occurring at each of the listed sites of the nephron, to generate the listed flow and osmolarity.

Blood flow into the glomerulus is at 280 mOsM, of which the albumin (large proteins) constitutes 90 mOsM. FLUID OSMOLARITY FLOW VOLUME Glomerular Filtrate 300 mOsM 7.5 L per hour End of Proximal Tubule 300 mOsM 2.5 L per hour End of Descending Loop 1200 mOsM 0.625 L per hour End of Ascending Loop 100 mOsM 0.625 L per hour Distal Tubule through End of Collecting Duct 100 mOsM 0.25 L per hour GLOMERULUS -PROXIMAL TUBULE -DESCENDING LOOP -ASCENDING LOOP -DISTAL NEPHRON

15) Describe the expected immune response to the following scenario: enveloped virus particles enter through the respiratory system, infecting epithelial cells of the upper airways. As the bronchial epithelial cells die and release new viral particles, these enter lymphatic capillaries and travel to the lymph nodes in the neck

. (16) A vaccine for Coronavirus is likely to take a longer time than imagined, because the most obvious target of the vaccine should be the external spike protein on the envelope of this enveloped virus. The cellular attachment protein on epithelial cells, which the virus binds to for entry into the epithelial cell, is known to be ACE2, a receptor enzyme. Explain why the production of a vaccine targeting the coronavirus spike protein (S1), is not likely to be successful.

Question 6:

(1 mark)

An mRNA has the following codon:

5? GCA 3?.

What tRNA anticodon will bind to this codon?

The tRNA anticodon 5'  3' will bind to the mRNA codon 5' GCA 3'.

**Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.**

1 points   

QUESTION 7

Question 7:

(1 mark)

A tRNA anticodon has the following sequence:

3' CUA 5'.

What amino acid does it carry?

The amino acid carried on a tRNA with the anticodon 3' CUA 5' is .

**Hint: You will need to consult the genetic code to answer this question. And watch your 5' to 3' direction.**

1 points   

QUESTION 8

Questions 8 to 13 are based on the following information.

Question 8:

The top strand of the following segment of DNA serves as the template strand:

3’ TACACCTTGGCGACGACT 5’

5’ ATGTGGAACCGCTGCTGA 3’

We will refer to this segment of DNA as the original (or unmutated) sequence.

Please answer the following questions:

(a) What is the mRNA sequence?

The mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.**

(b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated.

The amino acid sequence for this protein is N-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein.

i.e. input the amino acids in the order that they would be translated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with a hyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer this question.

4 points   

QUESTION 9

Questions 9 to 13 are in reference to the DNA sequence shown in Question 8.

Question 9:

The original (unmutated) DNA sequence (shown above in Question 8) has been mutated to the following (this represents the template strand):

3’ TACATCTTGGCGACGACT 5’.

We will refer to this sequence as mutation #1.

Please note that for simplicity only the template strand for this mutated segment of DNA is shown.

Answer the following questions:

(a) What is the complete mRNA sequence for the mutated segment mutation #1?

The mutated mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction. Deductions will be made if a sequence is inputted in the wrong direction.**

(b) Using the mRNA sequence you determined in part (a) of this question, give the sequence of the protein that would be translated.

The amino acid sequence for this protein is N-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequence for a protein, and the C-terminus refers to the end of the primary sequence for a protein.

i.e. input the amino acids in the order that they would be translated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with a hyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer this question.

Define and give examples of convergent evolution

• Use a phylogenetic tree to summarize the evolutionary relationships among vertebrates

• Identify the main characteristics of each major vertebrate group (fish, amphibians, reptiles, birds, mammals)

• List the four types of tissues that occur in all vertebrate bodies and summarize their functions

1.) Which bacteria grew in the widest range of temperatures?

a.) P.fluorescens

b.) B. gloibporus

c.) B. stearothermophilus

d.) E. oli

2.) Which of the following bacteria gre best at the lowest osmotic pressure?

a.) S.ruber

b.) E. coli

c.) S. aureus

d.) V. costicola

3.) Which statement explains what aerobes use oxygen to do?

a.) to insulate themselves in anaerobic enviroments

b.) to prevent free radicals from reacting with DNA and other vital molecules

c.) to provide the alcohol group added to organic compounds in fermentation

d.) to oxidize organic compounds for the release of energy and/or as a terminal electron acceptor

Come up with the best Genus species of bacteria for each case. Given the following description:

Gram (+) cocci arranged in grape-like clusters

Non-spore former

Produced the enzyme catalase

Beta-Hemolytic

Produces the enzyme coagulase

Acid from mannitol

Yellow-gold colony pigment

Novobiocin sensitive

Options are Micrococcus, Planococcus, or Staphyloccus.

Explain the morphology, physiology and virulence factors.

Explain how protists fit into the phylogenetic tree of life

Identify the basic structures common to fungi, including: cell walls, hyphae/mycelium, and spores

Give an overview of the haploid/diploid life cycle of fungi and compare to the haploid/diploid cycle in animals

Describe the following symbiotic relationships of fungi and their ecological impacts: • Mycorrhizae • Lichens • Parasitic/pathogenic fungi

8. Define the term mycosis, and differentiate between systemic mycosis, subcutaneous mycosis, and superficial mycosis. If a person contracted a fungal disease that was caused by the group of fungi known as dermatophytes, what type of mycosis would this be? Why is this group of fungi able to cause this type of infection and how it is usually transmitted?
   

Tristan is a lively little boy who attends daily day-care. He has severe allergies so his parents have not allo to receive the usual childhood vaccination series for fear of a severe reaction. For the last few days he has ha & swollen throat, fever & won't eat. Inside his mouth a greyish slime, a type of membrane, can be seen at the his throat . His parents take him to Urgent Care . 1. What's your disease diagnosis ? 2. What treatment should be used to combat the effects of toxemia? 3. Why would this tx be a particular challenge for this little boy?

Describe how graded potentials are regulated and how they regulate action potential firing. In your answer, specifically identify where on a neuron each event occurs.

1. Directions: Identify the restriction sites for each of the examples given. Show the cuts, mention if they are sticky ends or blunt, 5’ overhangs or 3 ‘overhangs and the number of DNA fragments produced and the number of base pairs in each (count the top row).

            Remember: Analyze in the 5’à 3’ direction

1. HindII --- 5' GTC ↓GAC 3'

5' ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3'

3' TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5'

Number of pieces of DNA _______

2. EcoRI --- 5' G ↓AATTC 3'

5' ACG ACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'

3' TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5'

Number of pieces of DNA _______

3. HaeIII --- 5' CC ↓ GG 3'

5' ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3'

3' TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5'

Number of pieces of DNA _______

4. BamI --- 5' CCTAG ↓G 3'

5' ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3'

3' TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5'

Number of pieces of DNA _______

5. HindII --- 5' GTC ↓- GAC 3' and HaeIII --- 5' CC ↓ GG 3'

5' ACGGTCGACACGTATTATTAGTCGACTCCGCCGCCGCCGGTCATCA 3'

3' TGCCAGCTGTGCATAATAATCAGCTGAGGCGGCGGCGGCCAGTAGT 5'

Number of pieces of DNA _______

6.   HindII --- 5' GTC ↓ GAC 3', HaeIII --- 5' CC ↓ GG 3' and BamI --- 5' CCTAG ↓ G 3'

5' ACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCG CCCCTAGGGTCATCA 3'

3' TGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5'

Number of pieces of DNA _______