Questions
ESSAY QUESTION The Central Nervous System is considered “immunologically privileged.” What does this mean?What are the...

ESSAY QUESTION

The Central Nervous System is considered “immunologically privileged.” What does this mean?What are the features of the anatomical structures that that enable this status. What are the factors that can cause a breech into the status of this system?

How do these characteristics play a role in the efficacy of treating infections in the Nervous System,and can they contribute to the occurrence of latent infections within this system?

In: Biology

Climate Change and Global Warming                                   Chapter 9 What

  1. Climate Change and Global Warming                                   Chapter 9
  • What are the causes of global warming?
  • What are the consequences of global warming?
  • What are the mitigation and adaptation policies?

Questions are from the Textbook "The Environment and You"

In: Biology

During mismatch repair, how does the cell “know” which strand to degrade and repair? Why will...

During mismatch repair, how does the cell “know” which strand to degrade and repair? Why will it lose this ability after a certain amount of time? Provide a reason that might explain why it is safer to degrade the new strand of DNA rather than the parental strand.

In: Biology

1) You sent off a sample for sequencing in order to aid in prescribing the proper...

1) You sent off a sample for sequencing in order to aid in prescribing the proper treatment and got the following sequence back:
a. TGGATTATGCGATGTCGGTCATTTTGGACCGGGCTTTGCGCATATCGCAGACGGTTTAAAGCCCGTCCAGCGTCGAATCGTGTACGCCATGTCAGAATTGGGTTTAAAATCAACCGCTAAGTATAAGAAATCAGCGCGGACGGTAGGCGACGTTTTGGGTAAATTCCATCCGCACGGAGACACCGCCTGTTACGAGGCCATGGTATTGATGGCCCAACCTTTTTCATTTCGCTATCCCTTTGTCGATGGGCAAGGCAATTGGGGGAGCGCGGATGATCCC AAATCCTTTGCCGCCATGCGTTATACGGAAGCACGTCTG
b. Describe the complete process, step by step, that this protein plays a role in.

2)Use an online tool to transcribe and translate the sequence and paste below. Describe how that would be done inside the cell of the pathogen in detail.

3)E.coli has a glutamine at position 87 in this protein. Our pathogen has a glycine. Speculate on how this affects the organism and it’s ability to cause/maintain/spread disease in humans. Give molecular detail.

In: Biology

Why do you think that phosphorylation and dephosphorylation has evolved to the point that it has...

Why do you think that phosphorylation and dephosphorylation has evolved to the point that it has such a prominent role switching proteins on and off in signaling pathways? (as opposed to, for example, using the allosteric binding of small molecules)

In: Biology

One species of plant produces blue, light blue, and white flowers. To determine the inheritance pattern,...

One species of plant produces blue, light blue, and white flowers. To determine the inheritance pattern, the following matings were performed:

blue x blue to blue

white x white to white

blue x white to light blue

This example represents a pattern: (choose the best option)


a. Associated with the X chromosome

b.Incomplete Dominance

c. Codominance

d.Mendelian

In: Biology

Describe (in detail) similarities and differences in pond structure between Green Library and OE Ponds. Choose...

Describe (in detail) similarities and differences in pond structure between Green Library and OE Ponds. Choose one abiotic and one biotic factor that affects primary productivity. In the context of your results, explain how these factors affect photosynthesis and respiration as well as Net Primary Productivity (NPP) and Gross Primary Productivity (GPP).

Green library pond: Is bigger, more space for species, minimum shade, recives a lot of light, water is more clear (assuming less disposal of nutirents.

OE pond: Is smaller, less space for species, a lot of shade/ almost no sun exposure, water is dark (assuming more nutrient disposal.

In: Biology

A woman is heterozygous for X-linked disease (Hemophilia A). If she marries a man without hemophilia,...

A woman is heterozygous for X-linked disease (Hemophilia A). If she marries a man without hemophilia, is there a chance that her daughters will suffer from the disease?(choose the best option)

a.only daughters can suffer from the disease

  b.both daughters and sons can suffer from the disease

  c.none of the children will suffer from the disease

  d.only children can suffer from the disease

In: Biology

1. In CRISPR, why does it make sense to design our crRNA first before making any...

1. In CRISPR, why does it make sense to design our crRNA first before making any other changes to the genomic DNA?

2. In CRISPR, when searching for PAMs, GGNGG makes a much better PAM than NGG - why is this?

In: Biology

A female with Muppetrus bristle mates with a male with Rheingoldenbach body color, producing the following...

 A female with Muppetrus bristle mates with a male with Rheingoldenbach body color,
producing the following counts:

F1 Generation
Males
WT-WT   Disease-WT      WT-Disease      Disease-Disease
260     252             0               0

Females
WT-WT   Disease-WT      WT-Disease      Disease-Disease
258     255             0               0

I have determined that at locus 1, the mode of inheritance is sex linked and at locus 2, the mode of inheritance is autosomal recessive.

Could someone help me determine the expected number of individuals that will have the following phenotypes, and fill out the E column.

Chi Square test:

Gender

Two locus phenotype

Observed (o)

Expected (E)

(o-E)^2 /E

Female

WT/ Disease

0

Disease/Disease

0

Disease/ WT

255

WT/WT

258

Male

Disease/WT

252

WT/disease

0

WT/WT

260

Disease/Disease

0

Total

1025

DF=

P value=

In: Biology

how can gel electrophoresis be used to determine whether a ligation experiment was successful? Be specific...

how can gel electrophoresis be used to determine whether a ligation experiment was successful? Be specific with what you would expect to see in the various lanes of the gel if a ladder, comtrol ( digested plasmid + insert without ligase) and sample ( digested plasmid + insert with ligase) were run.

In: Biology

The AmpR gene on plasmid pGLO gives cell resistance to Ampicillin. Explain what that means and...

The AmpR gene on plasmid pGLO gives cell resistance to Ampicillin. Explain what that means and how this gene provides that.

In: Biology

What basic lessons were learned in the classic experiments about gene regulation and regulation of the...

What basic lessons were learned in the classic experiments about gene regulation and regulation of the even-skipped gene by CRMs that determine stripe two formation in Drosophila embryos?

In: Biology

. Describe the V(D)J recombination process in terms of the sequence of events that occurs and...

. Describe the V(D)J recombination process in terms of the sequence of events that occurs and the enzymes involved at each step (4 points). Describe why V(D)J recombination is crucial for adaptive immunity

In: Biology

how would loop dilution, spread plate, and streak plate isolation techniques be affective by the use...

how would loop dilution, spread plate, and streak plate isolation techniques be affective by the use of selective medium

In: Biology