Answer the following questions based on this codingstrand of DNA:                                    

                                    5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’

Drennan et al. (1996) identified several mutations in this enzyme that result in methylmalonic acidemia (MMA). One of those mutations is a C to A at base pair 1904 in the coding strand of DNA (bold and italicized in the template strand).

1. Write the unique coding strand of DNA for this patient and highlight the change you made. Write it 5’ to 3’.
2. Write the mRNA sequence for this patient and clearly highlight the change you made. Write it 5’ to 3’.
3. Write the amino acid sequence for this patient, highlight what differs from the normal (wildtype) sequence.
4. What type of mutation is this? (insertion, deletion, silent, nonsense,missense,or frameshift mutation? Explain your reasoning.

Sea cucumbers (see figure) are classic hydrostats- cylindrical in shape with a body wall surrounding a constant volume of water. Many sea cucumber species crawl along the substrate using peristaltic locomotion (waves of alternating muscle contraction) while some species burrow into the substrate, which requires force to displace sediment. How might (a) the fiber angle of the collagenous body wall and (b) the initial shape of the animal correlate with peristaltic locomotion versus burrowing?

In osmosis, when will there be changes in volume of the two compartments separated by a selectively permeable membrane?

Climate change and an increasing population present an unprecedented challenge for food security in the coming decades. Propose and justify one or more ways in which we could increase or safeguard food production.

What do we know about Homo floresiensis? How old is it, where did it live, what did it look like? And, why is this a considered, by many, to be a controversial find?

What is meant by race? If you had a friend who told you that there were three clearly defined races, and another friend insisted that there were really five races, would you agree or disagree with each of them and why? Why can’t everyone agree on the number of races existing in the world today (what problems arise when people attempt to define someone by race)?

What is a polytypic species and what does it mean when one states that humans are members of the same polytypic species?

Upon surveying the material properties of all animals in a coral reef, you find that many materials that organisms use to build their structures are relatively strong, but not necessarily stiff. (a) Describe how a material can be strong, but not stiff. (b) What advantages might an animal gain by having structures whose proper functioning depends on their being adequately strong more than adequately stiff?

“Multicellular organisms can only exist due to cell signalling pathways”. Critically discuss this statement supporting your arguments with specific and relevant examples.

Why do scientists do experiments using PCR? More specifically, what are the temperatures used for PCR and what are the objectives for each temperature?

You are studying a transcriptional activator protein called CYK1, which activates cytokine genes in immune cells and has both a nuclear localization and a nuclear export signal and is normally found both in the nucleus and in the cytosol at comparable concentrations. CYK1 has a high-affinity binding partner in the nucleus (the binding partner is restricted to the nucleus). Upon activation of a certain signaling pathway, the binding protein partner is tagged for degradation. Explain the outcome of activation of the signaling pathway on cytokine gene expression and the localization of the transcriptional activator.

The physiological function of brown adipose tissue is to produce heat using a mitochondrial protein, thermogenin, also called uncoupling protein-1 (UCP-1). It was previously thought that in humans, uncoupling proteins (UCPs) were present only in newborn babies since adult humans lack brown fat; however, two other members of the uncoupling protein family, UCP2 and UCP3, were identified in adults. This was realized after investigators produced UCP1-knockout mice that were missing the gene for the UCP1 protein; even after knockout, they noticed that there was still finite proton leakage across the inner membrane that could not be explained by simple proton diffusion. Subsequent studies in transgenic mice showed that over expression of UCP3 results in reduced body weight gain and adiposity (even after they consumed more food). Because of studies such as these, UCPs are being studied as targets for treating obesity. In adults, UCP2 and UCP3 are expressed in white adipose tissue and skeletal muscle. Discuss how and why induction of UCP2 or UCP3 might be helpful in treating obesity and maintaining a constant amount of adipose tissue.

1.Chlorpyrifos insecticide exposure in the general population is often measured directly. The methodology for measuring exposure specifically to chlorpyrifos involves…

a.Collecting blood and measuring the parent compound

b.Collecting saliva and measuring the parent compound

c.Collecting blood and measuring trichloropyridinol

d.Collecting urine and measuring dialkyl phosphate residues

e.Collecting urine and measuring trichlorpyridinol

2.Consumers spraying their lawns for control of white grubs with the formulation Dursban prior to its removal from hardware stores like Home Depot and Ace were estimated to have a high end exposure of about 0.015 mg/kg/day. Considering that this product would only be applied once or twice a growing season, the margin of exposure (MOE) relative to the acute no observable adverse effect level (NOEL or NOAEL) of 0.5 mg/kg/day is __________. This exposure is _________ (above or love) EPAs levels of concern (LOC).

3.. When EPA assesses risk to endangered species, the agency uses an effective safety factor of [___________].

4.In the pesticide registration eligibility decision making process, what two types of data does EPA routinely use to estimate risk to aquatic invertebrates?

a.48 hour LC50 of Culex spp.

b.48 hour LC50 of Daphnia spp.

c.96 hour LC50 of Onchorynchus spp.

d. 96 hour LC50 of Bombus spp.

e.Results from PRZM and EXAMS

f.Results from the USGS NAWQA Database

g.Results from chemical company residue monitoring studies