|
Adjustment in high altitude includes ____________. |
|
an increase in minute respiratory volume |
|
hypersecretion of erythropoietin |
|
dyspnea |
|
an increase in hemoglobin saturation |
|
A and D |
In: Biology
Is Alzheimer's disease a chronic disease? Explain
In: Biology
How does size exclusion column work and what are the rate limiting factors in purification method?
In: Biology
Elaborate on the type of stains used for the following:
Endospores
Flagella
Capsule
White blood cells
In: Biology
In: Biology
Match each term with its definition.
|
The organelle responsible for energy production in both animal and plant cells |
|
|
The structure found in plant cells but not animal cells |
|
|
A substance composed of proteins secreted by cells that holds cells together in tissues |
|
|
The organelle that carries proteins from the rough endoplasmic reticulum to the Golgi |
|
|
The organelle that processes and sorts proteins |
|
|
A network of fibers that provides mechanical support to cells |
|
|
Consists of two phospholipid bilayers and contains pores |
|
|
The organelle that makes steroids |
|
|
Structures on some protists and sperm cells that enable locomotion |
|
|
The organelle that breaks down old or damaged organelles |
cytoskelecton
golgi apparatus
ftagella
lysosome
mitoxhondria
extracelluar matrix
nuclear envelop
cell wall
transport vesicle
smooth endoplasmic reticulum
In: Biology
The health of an organism depends on a process that controls the balance of water uptake and loss. This process is called:
Answer:
Enzymes speed up chemical reactions. The scientific term for “speed up” is:
Answer:
The process of water molecules crossing a membrane to the side that has a higher concentration of solute is called:
Answer:
Question text
The sum of all chemical reactions in an organism is called:
Answer:
The process of releasing large molecules to the outside of the cell is called:
Answer:
In: Biology
The following sequence of 30 nucleotides corresponds to one of the two strands of a double stranded DNA:
5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’
a) This sequence has two perfect palindromes that consist of 6 base pairs each. What is the sequence of these two palindromes?
b) Show both strands of your FIRST palindrome (indicate the 5’-3’ polarity)
c) Show both strands of your SECOND palindrome (indicate the 5’-3’ polarity)
Assume that the two palindromes are recognized by “6-cutter” restriction enzymes, and that each enzyme creates blunt ends. Assuming the 30bp DNA sequence is digested with BOTH enzymes, and that the resulting dsDNA fragments are stable (i.e. the complementary strands remain annealed):
In: Biology
1. How is evolution important to current/furture medical practive (for practitioner and patient, with examples)
2. Describe how evolutionary theory allows for a better knowledge about human behavior and how does this impact the understanding of various human behaviors that are diverse (with examples)
3. how does this have value to life. (with examples)
In: Biology
Why do phospholipids form a bilayer in water-based solutions?
In: Biology
1. Which checkpoint and phase of the cell cycle is the expression of BRCA1 and BRCA2 the greatest? What is the function of BRCA1 and why would it make sense that its expression is high at the checkpoint/phase of the cell cycle?
2. Outline the two parts of the eukaryotic cell cycle and describe the three main checkpoints in cell cycle regulation.
*PLEASE ANSWER QUESTIONS AS SIMPLY AS POSSIBLE. I AM IN A BASIC GENETICS COURSE*
*The answers should be completed in a paragraph or less for each question. Please and thank you!*
In: Biology
The promoter region in bacteria is called the -35 and -10 region.
True or False
In: Biology
In: Biology
What is the purpose of publishing in a scientific journal?
In: Biology
Discuss the biological efficiencies gained by organizing protein function on a membrane (hint: one critical point is the membrane serving as an interface between environments). Provide an example for each.
In: Biology