Both alcohol and caffeine affect the neurological system. Although alcohol is a controlled substance, caffeine is not. Develop an argument to make caffeine (coffee and other caffeinated beverages) a controlled substance.

Microbiology

Meningitis Case Study #3

Patient A: A 73-year-old Guatemalan man named Francisco Salazar was brought into the ER by his daughter with a chief complaint of a 5-day history of fever, back and neck pain, headache, and confusion. Francisco’s daughter notes that they live on a dairy farm and he has a history of cirrhosis and non-insulin dependent diabetes. A lumbar puncture was performed for cerebrospinal fluid (CSF) analysis.

Patient B: Alice Chen, a 6-year-old female, presented to the emergency department with a 4-day history of worsening headache and a rash on her trunk. Her mother mentioned that over-the-counter medications had no effect on her headache. Alice mentioned that the bright lights of the examination room hurt her eyes and she stated that her “head hurts all over.” She also had difficulty trying to move her neck. A physical test revealed some vesicular lesions on her hands and feet. A lumbar puncture was also performed for cerebrospinal fluid analysis.

Patient A has Bacterial Meningitis

Patient B has Viral Meningitis

What specific disease do they have, how do you treat it, and what is the prognosis

What is the key difference between financial statement analysis and operating indicator analysis? How are these types of analyses useful to healthcare managers and investors? Consider a healthcare organization with which you are familiar and discuss what are some of the problems or challenges inherent in financial statement analysis?

The genome of herpes-type viruses is linear double-stranded DNA. Acyclovir is an agent
antiviral that inhibits DNA replication in cells infected by this virus. It is administered to
patients in dephosphorylated form although it acts only after it is modified by
phosphorylation. 

a) Propose a possible mechanism of inhibition of replication.
b) Acyclovir has very few side effects because it is only modified in cells
infected. Explain.
c) Herpes virus can become insensitive to acyclovir therapy by mutations in two
genes. Discuss what those genes might be.

Describe the general flew of lymph from lymphatic capillaries through return to three circulatory system. Include relevant structures and functional aspects of this journey.

What do I do for this? I am confused in what to do.

Choose a developmental domain covered in Module 2 (motor, self-care, cognitive). Provide a rationale for why development in this area is important for overall child development. Provide three strategies you would recommend caregivers implement at home to advance their childrens' skills in the chosen developmental domain.I chose the Self-Care domain.

4. How many mutations and other sequence variants have been reported in dbSNP for human CFTR?

[please be detailed, thanks]

1. What are the k-mers of length k = 21 for this sequence read in FASTQ format?

@K000384:75:HM57CBBXX:1:1101:25530:1384 1:N:0:GTGGCC

CTGGCACTGGGCTTCAAGCTGGGCTACCTTCTGTTT

+

AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

[please be detailed, thanks]

Question 8.  A transmembrane protein uses a β barrel structure to span the cell membrane.  How can amino acid mutations in a protein within this β barrel structure affect interactions with the membrane and why? (Up to 50 words)  

Question 9.  Haemoglobin is a protein that carries oxygen in our red blood cells.  Sickle cell anaemia is a genetic disease in which Glu at position 6 of haemoglobin is mutated to a Val, rendering haemoglobin non-functional.

1. What type of amino acid change is this?  (1 mark)

2. Give one reason why this could affect the function of this protein.  (1 mark)

Question 10.  Lectin is a protein that binds carbohydrates and is critical for biological recognition processes in living organisms.  Describe what bonds and forces could be involved in lectin and carbohydrate interactions. (Up to 50 words)  

Question 11.  A hexokinase is an enzyme that adds a phosphate to glucose after it enters the cell, which is considered the first step of glycolysis.  One enzyme, hexokinase A (HKA), has a K_m of 0.02 mM, whereas another, hexokinase B (HKB), has a K_m of 1.0 mM.  Explain why some types of fast growing cancer cells would use HKA instead of HKB. (Up to 50 words)  

Describe how the “kidney” works in amphixous using the anatomical terms we discussed in lecture and then a possible mechanism of how it may move materials from the blood

Describe the 3 major anatomical advances/adaptations that occurred in the vertebrates and explain how each added to its success and size increase

Differentiate between the three major phyla of bryophytes by identifying their defining characteristics

1) Describe the types of bacterial cell arrangements and how the different planes of cell division determine their arrangements. Why Bacilli are less varied in arrangement than cocci? 2) Mycoplasmas are classified as Low G + C Gram-Positive Bacteria in the textbook. However their staining phenotype indicates they are gram negative. What is the basis for classification as gram positive bacteria? 3) Make a dichotomous key to distinguish among the orders of Gammaproteobacteria

The second PCR you perform requires that only 3-10ng of PCR product be used for ideal results. This, of course, must be paired with careful lab technique, such as keeping the sequencing PCR mix ice-cold and not contaminating the reaction with outside sources of DNA such as that on your fingertips. The following steps will take you through a proper dilution of the PCR product so that you get the appropriate concentration of DNA for your sequencing reaction. Remember: you cannot pipet 0.5 µl or 1 µl with a P20 micropipettor. The lowest volume you can pipet is 2 µl. Attempting to set it lower than that can break the equipment!

As per the instructions on page 35 of your manual, you need to add:

4 µl of [PCR product + water] that has a total of 3-10ng of DNA

to the 0.2ml PCR tube that already contains 6 µl of the Big Dye Master Mix (=Sanger Sequencing PCR Mix) to get a 10 µl reaction.

If you need 3-10 ng/4 µl, what is the DNA concentration range per 1 µl required?

Many of you will have a band equally bright to the 500bp SS band, so go back to #3 in Step 1 and record that amount here:

______________ ng DNA/ µl PCR product

How many times higher is the concentration of DNA in #7 as compared to the concentration required per microliter (#6)?    [For example, if you had a sample that had 1500ng DNA/µl and you needed ~125ng DNA/µl, your sample would be 12x higher than it should be.]

To get DNA at the volume and concentration you need, use the # calculated in #8 to determine your proportion of sample:water. This diluted DNA would need to be mixed in an empty, separate tube and can be at any volume so long as the ratio is correct (though keep in mind you only have ~40 µl of PCR product remaining).

Using the example from #8, if we had a sample that was 12x more concentrated than required, we would make a dilution that was 1/12 sample and 11/12 water. This would be a 1:11 ratio. Since the minimum volume we can accurately pipet is 2µl, we could make a tube with 2µl sample (=3000ng DNA) and 22µl water = total of 3000ng DNA/24µl water = 125ng/µl.   4µl of this diluted DNA could then be pipetted out and added to the desired reaction.

Work with your partner to determine how to make a DNA dilution that would be appropriate for sequencing, yielding at least 4µl total volume containing only 3-10ng DNA. Again, your minimum pipetting volume is 2µl.