Questions
List some preventive and control measures for students regarding alcohol and drugs abuse.

List some preventive and control measures for students regarding alcohol and drugs abuse.

In: Biology

List the harmful effects caused by alcohol/drug abuse. Ans. Harmful effects caused by alcohol/drug abuse. Drug...

List the harmful effects caused by alcohol/drug abuse. Ans. Harmful effects caused by alcohol/drug abuse. Drug abusers who take it intravenously may cause

In: Biology

Which type of organ is spleen? What is its role and function in the body?

Which type of organ is spleen? What is its role and function in the body?

In: Biology

Given the DNA sequence matrix below: Fern AGCCCAGGCTTCGAATGTCC Pine AGCTTCAGTGTCGCACTTCC Oak AGCTTCAGCGTCACACATCC Moss AACCTTGGTGTCAAACGTCC 1. Assuming...

Given the DNA sequence matrix below:

Fern AGCCCAGGCTTCGAATGTCC
Pine AGCTTCAGTGTCGCACTTCC
Oak AGCTTCAGCGTCACACATCC
Moss AACCTTGGTGTCAAACGTCC

1. Assuming that Moss is the outgroup, draw all three possible trees of evolutionary
relationships among these species. Label your trees A, B, and C.


2. Sum up the number of differences between the DNA sequences for all pairs of species
(There are 6 total pairs of species to be compared). Based on these values, which tree (A,
B, or C) do you think is best under the Genetic Distance criterion?


3. Determine the minimum number of mutations required under the parsimony criterion for
each of the three trees. Which is the most parsimonious tree?

In: Biology

What is vaccination? What is the role of vaccines in body? Give two examples when immediate...

What is vaccination? What is the role of vaccines in body? Give two examples when immediate response is needed by body to defend it, name this type of immunization.

In: Biology

Which type of organ is spleen? What is its role and function in the body?

Which type of organ is spleen? What is its role and function in the body?

In: Biology

How is a cancerous cell different from a normal cell?

How is a cancerous cell different from a normal cell?

In: Biology

Answer each with a few sentences please: 1. Epiphyseal plate function and increase in length of...

Answer each with a few sentences please:

1. Epiphyseal plate function and increase in length of a long bone

2. Osteoclast functions in bone ECM degradation

3. Cells in the osteogenic periosteum and what they do

4. Comparison of osteogenic and chondrogenic stem cells

In: Biology

What is vaccination? What is the role of vaccines in body? Give two examples when immediate...

What is vaccination? What is the role of vaccines in body? Give two examples when immediate response is needed by body to defend it, name this type of immunization.

In: Biology

(answer with a paragraph or a few sentences for each) 1. The structure of cartilage (in...

(answer with a paragraph or a few sentences for each)

1. The structure of cartilage (in general), how types of cartilage differ from one another, and the importance of the perichondrium associated with cartilage

2. The activity of osteoblasts, balancing osteoclast activity with osteoblast activity, and ways through which various signal molecules control osteoclast activity

3. Comparison of cartilage and bone (particularly a long bone) with respect to the blood supply that supports cells of the tissue

In: Biology

Which of the following is correct order of the evolutionary history of man? (a) Peking man...

Which of the following is correct order of the evolutionary history of man?

(a) Peking man homo sapiens, Neanderthal man, Cromagnon man

(b) Peking man, Heidelberg man. Neanderthal man, Cromagnon man

(c) Peking man, Heidelberg man. Neanderthal man, Cromagnon man

(d) Peking man, Neanderthal man. Homo sapiens, Heidelberg man.

In: Biology

Compare and contrast the following macromolecules in terms of their structure, function, synthesis and significance to...

Compare and contrast the following macromolecules in terms of their structure, function, synthesis and significance to the cell:

1. proteins

2. carbohydrates

3. lipids

4. aromatic bases

Which of the above could the cell survive longest without? Why?

In: Biology

Were Lamarck's ideas scientific? How so? How might you test his hypothesis for evolution?

Were Lamarck's ideas scientific?

How so? How might you test his hypothesis for evolution?

In: Biology

Theory of inheritance of acquired characters was given by (a) Wallace (b) Lamarck (c) Darwin (d)...

Theory of inheritance of acquired characters was given by

(a) Wallace

(b) Lamarck

(c) Darwin

(d) De Vries.

In: Biology

Biochemistry question: Describe the four levels of proteins structure (primary, secondary, tertiary and quaternary). Make sure...

Biochemistry question:

Describe the four levels of proteins structure (primary, secondary, tertiary and quaternary). Make sure to describe the role of non-covalent interactions involving the main chain or side chains of the amino acids that form to stabilize the structure.

In: Biology