In this week’s lab you will look for examples of phenotypic variation within and between species of plants, using both your unassisted eye and a microscope. But what sorts of phenotypeswill you not be able to observe in lab, and might they be variable, too? In your answer, detail two other kinds of unobservable (with our methods) phenotype that might vary within and between species and give a concrete example of each.

Neither Tsar Nicholas II nor his wife Empress Alexandra had the disease known as hemophilia, characterized by being linked to sex. Her daughter, the princess Anastasia didn't have it either, but Zarevich Alexius, her brother, did.
a) Can it be assumed that Anastasia was "carrier" of the information for the hemophilia?
b) Why?
c) If she had married her cousin Henry, who was a hemophiliac, would it have been any of your sons or daughters? Specify possible cases

1. Using your knowledge of DNA replication, copy the following. Write down all the important steps and players of the reaction. Show the primer location and derive the complimentary strand sequence.

5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`

You just isolated a new strain of mutant mice, and preliminary mating suggest that the new mutant phenotype is not inherited in an autosomal fashion. Circumstantial evidence seems to indicate that the mutant phenotype may be following either an X-linked dominant or a mitochondrial-type inheritance pattern.

a.) What two informative crosses would you set up to distinguish between these two possibilities?

b.) How would the results distinguish between the two possibilities?

Testing the goodness of fit between the data and the Hardy Weinberg equilibrium model generated expectations.

4.1 In a species of bird, feather color is controlled by genes at a single locus, with the red feather allele dominant to the yellow feather allele. A population has 22 red and 14 yellow birds, with 9 of the red birds having a homozygous dominant genotype. Is this population in equilibrium?

Calculate p and q from the number of individuals of each genotype:

p = ____

q = ____

Calculate the expected frequency of each genotype if the population is in equilibrium:

_____ = Frequency of homozygous dominant individuals

_____ = Frequency of heterozygous individuals

_____ = Frequency of homozygous recessive individuals

Calculate the expected number of individuals of each genotype in a population of 36 birds if the gene is in equilibrium:

_____   = Number of homozygous dominant individuals

_____   = Number of heterozygous individuals

_____ = Number of homozygous recessive individuals

Test how well your data fits the expected values from the equilibrium model:

_____ = Chi-square test statistic

_____ = P value

_____ (y/n) in equilibrium?

4.2 In a species of mouse, tail length is controlled by genes at a single locus, with the long tail allele dominant to the short tail allele. A population has 49 long tail and 25 short tail mice, with 22 of the long tail mice having a homozygous dominant genotype. Is this population in equilibrium?

Calculate p and q from the number of individuals of each genotype:

p = _____

q = _____

Calculate the expected frequency of each genotype if the population is in equilibrium:

_____   = Frequency of homozygous dominant individuals

_____   = Frequency of heterozygous individuals

_____   = Frequency of homozygous recessive individuals

Calculate the expected number of individuals of each genotype in a population of 74 mice if the gene is in equilibrium:

_____   = Number of homozygous dominant individuals

_____   = Number of heterozygous individuals

_____   = Number of homozygous recessive individuals

Test how well your data fits the expected values from the equilibrium model:

_____ Chi-square test statistic

______ P value

_____ (y/n) in equilibrium?

4.3 In humans, the hitchhiker’s thumb trait is controlled by genes at a single locus, with the non-hitchhiker’s thumb allele dominant to the hitchhiker’s thumb allele. A population has 46 people that do not have the hitchhiker’s thumb and 21 that do. Of the humans without a hitchhiker’s thumb, 19 have a homozygous dominant genotype. Is this population in equilibrium?

Calculate p and q from the number of individuals of each genotype:

p = _____

q = _____

Calculate the expected frequency of each genotype if the population is in equilibrium:

_____   = Frequency of homozygous dominant individuals

_____   = Frequency of heterozygous individuals

_____   = Frequency of homozygous recessive individuals

Calculate the expected number of individuals of each genotype in a population of 67 humans if the gene is in equilibrium:

_____   = Number of homozygous dominant individuals

_____   = Number of heterozygous individuals

_____   = Number of homozygous recessive individuals

Test how well your data fits the expected values from the equilibrium model:

_____   Chi-square test statistic

______ P value

_____ (y/n) in equilibrium?

4.4 In a certain species of prickly pear, having straight or curved spines is a trait controlled by genes at a single locus, with the straight spine allele dominant to the curved spine allele. A population of prickly pears has 37 individuals with straight spines and 42 individuals with curved spines. Of the prickly pears with straight spines, 12 have a homozygous dominant genotype. Is this population in equilibrium?

Calculate p and q from the number of individuals of each genotype:

p = _____

q = _____

Calculate the expected frequency of each genotype if the population is in equilibrium:

_____   = Frequency of homozygous dominant individuals

_____   = Frequency of heterozygous individuals

_____   = Frequency of homozygous recessive individuals

Calculate the expected number of individuals of each genotype in a population of 79 prickly pear cacti if the gene is in equilibrium:

_____   = Number of homozygous dominant individuals

_____   = Number of heterozygous individuals

_____   = Number of homozygous recessive individuals

Test how well your data fits the expected values from the equilibrium model:

_____   Chi-square test statistic

______ P value

_____ (y/n) in equilibrium?

although moving onto land had its benefits plants,were faced with some major challenges if they were to be successful. please explain two benefits and two challenges they faced and describe adaptations they evolved to meet both

challenges faced by plants during their transition from water to land and the adaptations that they developed to over those challenges and what are the benefits of colonizing land

War on Cancer

The underlying assumption of most approaches contained within the War On Cancer is that we can find one cure for all cancers. Consider just two types of cancer: basal cell carcinoma and colon cancer. These are both caused by a combination of what particular alleles of certain genes a person is born with, and mutations that accumulate due to environmental exposure and the process of aging. Some of the genes are shared, and some differ between the diseases. How likely do you think it is that there is a single approach that can either prevent or cure both of these? How likely do you think it is that there is a single approach that can cure or prevent many cancers?

6c) Explain how eukaryotic organelles are able to transport materials between one another.

6d) Considering your answer from 6c, explain how cells are able to import and export large and larger amount of molecules across the plasma membrane.

You have isolated a strain of brewer’s yeast (Saccharomyces cerevisiae) in the lab for your second job at a hip new microbrew . You find that this strain ferments more efficiently and adds a superior flavor profile to your brews. You want to clone the strain of yeast and generate a genomic library to determine the genes responsible for this finding. To do so you:

1. Obtain fragments of the whole yeast genome (DNA) through restriction digestion
2. Open your vector and ligate the DNA fragments
3. Transform E. coli with these vectors
4. Select for E. coli that have obtained vectors
5. Screen for E. coli transformed with recombinant plasmids
6. Obtain recombinant plasmids from the library and transform yeast with them
7. Clone by complementation the gene that can give superior fermentation.

Note: the cloning site is within the lacZ gene.

a) (3 points) In step 3 you transform E.coli with your plasmids and plate them on a solid agar medium to grow and isolate colonies. What medium should you used to distinguish the bacteria transformed with recombinant vectors from ones that carry non-recombinant vectors? Briefly explain how the medium allows for you to distinguish. (hint: look up the substrate X-gal)

b) (2 points) You identify a recombinant vector that passes your complementation test. You are curious whether this vector will cause bacteria to ferment sugars for brewing. Provide and explain two reasons why this recombinant vector will NOT work in bacteria.

. For each of the restriction enzymes listed below: (i) Approximately how many restriction fragments would result from digestion of the human genome (3 x 109 bases) with the enzyme? (ii) State whether the fragments produced by digestion with each enzyme would have sticky ends with a 5’ overhang, sticky ends with a 3’ overhang, or blunt ends. (The recognition sequence for each enzyme is given in parentheses, where N means any of the four nucleotides. ^ marks the site of cleavage.)

a. EcoRV (GAT^ATC)

b. HpaII (C^CGG)

c. DrdI (GACNNNN^NNGTC)

(h) Pseudomonas aeruginosa also uses the Entner-Doudoroff pathway to degrade glucose. Use IMG or BLAST (or MetaCyc) to identify which enzymes in the EMP pathway are missing from P. aeruginosa PAO1.

(i) Biochemical experiments performed by Robertson and McCullough (1968) suggested that Brucella abortus uses the pentose phosphate pathway, instead of the EMP or Entner-Doudoroff pathway, to degrade glucose. The labeling and enzymological results, obtained with B. abortus strain 19 grown in rich media in shaken culture, suggested that key enzymes are missing. Use IMG or BLAST (or MetaCyc) to identify which enzymes in the EMP and ED pathways are missing from B. abortus S19. Is there a discrepancy from experimental results? Explain.

Please only answer if you know the answer. Appreciated

In what polysaccharide does a redwood tree store its energy?

Describe the experimental procedure used to accomplish DNA transformation into bacterial cells.

Briefly describe the 3 signals involved in the activation and differentiation of a naive CD4+ T cell into an effector Th2 (T helper) cell.