PCR reactions are specific to particular pieces of DNA. Which component of the reaction allows for...

PCR reactions are specific to particular pieces of DNA. Which component of the reaction allows for this specificity? Explain how.

Sanger Sequencing (also called chain termination and dideoxy-sequencing) utilizes special dideoxy nucleotides (ddNTPs). What is the difference between these special nucleotides and the dNTPs used in PCR?

What role do the ddNTPs play in the sequencing reaction?

Expert Solution

gladiator answered 7 months ago

Which of the following is NOT a required component of a polymerase chain reaction (PCR)? A)...

Which of the following is NOT a required component of a polymerase chain reaction (PCR)? A) deoxynucleotides B) two primers C)DNA ligase D)heat stable DNA polymerase E) none of the above (i.e. all the above are required components of a PCR) E)

How are thermostable DNA Polymerases important for Polymerase Chain Reactions (PCR)?

Explain how PCR (polymerase chain reaction) works. After explaining PCR, compare PCR to the DNA replication...

Explain how PCR (polymerase chain reaction) works. After explaining PCR, compare PCR to the DNA replication that occurs naturally in living cells, making sure to give at least 4 similarities and 4 differences.

what does the polymerase chain reaction (PCR) accomplish? 1) PCR converts RNA to DNA 2) PCR...

what does the polymerase chain reaction (PCR) accomplish? 1) PCR converts RNA to DNA 2) PCR corrects mutation in a gene 3) PCR makes many copies of DNA segment 4) PCR joins short segments of DNA to make one long segment how does the ribosome select the next amino acid to add to a growing polypeptide chain? 1) the ribosome selects the amino acid that can form hydrogen bonds with the mRNA 2) the ribosome selects a tRNA that base-pairs...

Why are the following not needed in a PCR reaction while they are needed for DNA...

Why are the following not needed in a PCR reaction while they are needed for DNA replication in a cell? Helicase Topoisomerase Primase rNTPs RNase DNA ligase

2.9. Find the volumes of each component for a PCR master mix for 18 reactions. &

2.9. Find the volumes of each component for a PCR master mix for 18 reactions. No of reactions to make up 18 Vol of each Reaction (µL) 24 µL +1 µL DNA Total Volume Required µL total Component Supplied as Final Conc in PCR µL required 1rxn 18 rxn’s MgCl2 25 mM 2.5 mM Polymerase buffer 5x 1x Primer forward (Bird F1) 10 µm 1 µm Primer Reverse (Bird R1) 10 µm 1 µm Taq DNA polymerase 1Units/µL 1...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below. Region 1 Region 2 5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’ b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer? A....

in pcr practical, Briefly describe the reaction mechanism leading to the synthesis of a new DNA...

in pcr practical, Briefly describe the reaction mechanism leading to the synthesis of a new DNA strand by Taq DNA polymerase. In your answer include: i. The mechanism of the synthesis reaction, ii. The direction of the synthesis reaction iii. The direction in which sequence information is read from the template strand.

You are setting up a PCR reaction using DNA from a bacteria with a genome size...

You are setting up a PCR reaction using DNA from a bacteria with a genome size of 17 megabase-pairs (mb). How many nanograms of DNA will you need to add to the reaction to ensure there are at least 100 copies of the single gene you are trying to amplify? (assume the average molecular weight of a nucleotide pair is 650). (2 pt)

Define and explain their function in a PCR Reaction a) DNA polymerase b) Primers c) dNTPs...

Define and explain their function in a PCR Reaction a) DNA polymerase b) Primers c) dNTPs d) MgCl2 e) DNA

Question