learn how to find the nucleotide sequence of the complementary DNA STRAND

Expert Solution

To know the complementary DNA of a particular DNA sequence one must know the sequence of the template DNA.

Template DNA is the atrand of DNA which is used as a base for the replication. According to that ,the complementary DNA is prepared in an antiparallel manner.

Adenine (A) pairs with Thymine (T) in DNA. But in RNA there is no T, so the Adenine pairs with Uracil(U). Guanine (G) pairs with Cytosine (C) in both DNA and RNA.

For example:

5'ATGCAACCTAGCATGC3'(TEMPLATE DNA)

3'TACGTTGGATCGTACG5'(complementary strand)

3'UACGUUGGAUCGUAGC5'(RNA strand of template strand)

Give a thumbs up if you like the answer. Thank you

gladiator answered 2 years ago

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of...

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of DNA (below), write the sequence of the complementary strand indicating the appropriate 5' and 3 " ends.

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF ? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

1. What would the complementary strand of DNA be for these strands of DNA? (1 point...

1. What would the complementary strand of DNA be for these strands of DNA? (1 point each; 5 points total) a. 5’ – AGCTTGCATGGCTATT – 3’ b. 3’ – GCAATGGGCGCT – 5’ c. 3’ – AAATCCGATGCGCTA – 5’ d. 5’ – GCAGCAGCATTGCA – 3’ e. 3’ – GCAATCGCCGGTGCAC – 5’ 3 During what portion of the cell cycle does DNA replicate? How many times does DNA replicate before mitosis? How many times does DNA replicate before meiosis? (3 points) 4...

how to find the complementary genomic sequence of this oligonucleotides, please explain how to do find...

how to find the complementary genomic sequence of this oligonucleotides, please explain how to do find it. Oligo 1 5’-CGCTAGGATCGAACCATACTCGGAC-3’ Oligo 2 5’-CATAGAATTTACGCATACCTAAGAT-3’ Oligo 3 5’-TACGTACGTACGCGTACGTACGTA-3’

The sequence of nitrogenous bases in an RNA and DNA strand is always written in the...

The sequence of nitrogenous bases in an RNA and DNA strand is always written in the 5? to 3? direction because __________. 1. each strand of RNA or DNA has an unlinked 3? carbon and an unlinked 5? carbon 2. DNA and RNA are synthesized in this direction in cells 3. DNA strands are antiparallel 4. nucleotides are added to the 5? end of the nucleic acid

Question