Question

In: Biology

The sequence of nitrogenous bases in an RNA and DNA strand is always written in the...

The sequence of nitrogenous bases in an RNA and DNA strand is always written in the 5? to 3? direction because __________.

1. each strand of RNA or DNA has an unlinked 3? carbon and an unlinked 5? carbon
2. DNA and RNA are synthesized in this direction in cells
3. DNA strands are antiparallel
4. nucleotides are added to the 5? end of the nucleic acid

Solutions

Expert Solution

Answer is option 2: DNA and RNA are synthesized in this direction.

Explanation:

DNA and RNA both are polymers of nucleotides. There are four nucleotides (NT) A, G, C and T/U.

A and G are Purines, C and T/U are pyrimidines.

Each NT having 3 components, 1. Nitrogen bases (purines Aand G; Pyramidines C and T/U)

2. Ribose sugar (5 carbon compound)

3. Phosphate (PO4-3)

Ribose and Phosphate groups are acts as backbones. Nitrogen bases can form H-bonds.

First carbon in ribose sugar can form the bond with Nitrogen bases.

Second carbon having free -H and -OH groups in RNA but having only two free -H atoms in DNA.

Third carbon having free -OH group and -H atoms. This free OH group can form the bond with phosphate group of 5' carbon on another NT.

Fourth carbon having only one free -H atom.

Fifth carbon attached to fourth carbon and phosphate group. This 5' phosphate group can form the phospho-diester bond with 3' OH of previous NT.

Conclusion:

In DNA or RNA synthesis, the first NT 5' end having free phosphate group which not involved in any bonding but OH group on 3rd carbon of first NT can form phosphodiester bond with 5' phosphate of another NT. So the synthesis occurred only in 5' to 3' direction.

5' phosphate of first NT and 3' OH of last NT not involved in any bonding. So we represented the ends of DNA and RNA as 5' and 3'.


Related Solutions

1. It was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence...
1. It was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5 viral genes begins with 5’ GGGUACAUGGUAGCC….3’, the starting amino sequence is: a) N-terminal Tyr-His-Arg- C-terminal b) N-terminal Gly-Tyr-Met-Val-Ala- C-terminal c) N-terminal Val-Ala- C-terminal d) N-terminal Pro-Met-Tyr-His-Arg-   C-terminal e) N-terminal Met-Tyr-His-Arg-   C-terminal 2. Which of the following enzymes has the highest functional error? a) RNA Polymerase 1 b) DNA Polymerase 1 c) DNA Polymerase 3 d) RNA Polymerase 2 e)...
Describe the difference between Positive Strand RNA Viruses, Negative Strand RNA Viruses, RNA Retroviruses, and DNA...
Describe the difference between Positive Strand RNA Viruses, Negative Strand RNA Viruses, RNA Retroviruses, and DNA Viruses.
Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA...
Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA sequence of the DNA strand above and what is the amino acid sequence? If you have an RNA transcript that is 100 bp, how many codons does it contain? If you take the template DNA that is shown in question 1 and you mutate the 6thnucleotide from A to G how does that impact the polypeptide sequence Is it better to have a mutation...
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3'   T A C C G A T G G    5'
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
learn how to find the nucleotide sequence of the complementary DNA STRAND
learn how to find the nucleotide sequence of the complementary DNA STRAND
If one strand of the DNA has the sequence of AGCTTC what will be the other...
If one strand of the DNA has the sequence of AGCTTC what will be the other strand be ? A DNA nucleotide consists of Small extrachromosoal pieces of DNA found in prokaryotes which replicate independently of the of the chromosome and provide the cell with different traits are Codons are recognized during The role of translation is to
The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...
The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A.    5′—TTAACGTCTAAGT—3′ B.    3′—TTAACGTCTAAGT—5′ C.    3′—UUAACGUCUAAGU—5′ D.    5′—UUAACGUCUAAGU—3′
A DNA string is a sequence of the bases a, c, g, and t in any...
A DNA string is a sequence of the bases a, c, g, and t in any order, whose length is usually a multiple of three. In reality, it is not necessarily a multiple of three, but we will simplify it as such for discussion. For example, aacgtttgtaaccagaactgt is a DNA string with a length of 21 bases. Recall that a sequence of three consecutive letters is called a codon. Assuming the first codon starts at position 1, the codons are...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT