The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The...

The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC

The strand is transcribed from left to right and codes for a small peptide.

a) Is this the mRNA-like coding strand or template strand?

b) Which end is the 3' end and which is the 5' end?

c) What is the DNA coding strand sequence of the ORF ?

d) What is the sequence of the entire transcript (assume the +1 of transcription begins at the first nucleotide shown)?

e) What is the amino acid sequence of the peptide?

Expert Solution

gladiator answered 4 months ago

learn how to find the nucleotide sequence of the complementary DNA STRAND

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium...

The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium (the promoter sequence is located to the left but is not shown): 5’-GAATGTCAGAACTGCCATGCTTCATATGAATAGACCTCTAG-3’ Consider the ribonucleotide sequence of the mRNA molecule that is transcribed from this piece of DNA that you determined in the previous question. What is the amino acid sequence of the polypeptide encoded by this mRNA? You must show and explain all work/evidence to receive credit.

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA...

What are the functions of the following enzymes in E. coli? DNA polymerase I __________________________________________________ DNA polymerase II __________________________________________________ DNA polymerase III _________________________________________________ DNA polymerase IV _________________________________________________ DNA polymerase V _________________________________________________ Please indicate (if possible) which is the evolutionary history of these polymerases? Which of them you could be eliminate and preserve the function of the organism? (you must eliminate 2) What will be the consequences? Which environment might be suitable for the survival of this “mutant” that you created?

Which of the following is required for an insertion sequence element in E. coli to be...

Which of the following is required for an insertion sequence element in E. coli to be able to transpose? A gene for reverse transcriptase and long terminal repeats A gene for reverse transcriptase and inverted repeats A gene for transposase and inverted repeats A gene for transposase and long terminal repeats A gene for DNA polymerase and long terminal repeats Which type of deletions and/or insertion would not lead to frameshift mutations? A deletion that removes only a single amino...

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of...

Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of DNA (below), write the sequence of the complementary strand indicating the appropriate 5' and 3 " ends.

Question