Question

In: Biology

1. What would the complementary strand of DNA be for these strands of DNA? (1 point...

1. What would the complementary strand of DNA be for these strands of DNA? (1 point each; 5 points total)

a. 5’ – AGCTTGCATGGCTATT – 3’

b. 3’ – GCAATGGGCGCT – 5’

c. 3’ – AAATCCGATGCGCTA – 5’

d. 5’ – GCAGCAGCATTGCA – 3’

e. 3’ – GCAATCGCCGGTGCAC – 5’

3 During what portion of the cell cycle does DNA replicate? How many times does DNA replicate before mitosis? How many times does DNA replicate before meiosis? (3 points)

4 What is a primer? What are they made out of during DNA replication? Why does the process of DNA replication require the use of a primer? (4 points)

Solutions

Expert Solution

Ans.1- Complementary strand of DNA for this template strands would be:

a. 3'-TCGAACGTACCGATAA -5'

b. 5'- CGTTACCCGCGA -3'

c. 5'- TTTAGGCTACGCGAT - 3'

d. 3'- CGTCGTCGTAACGT - 5'

e. 5' - CGTTAGCGGCCACGTG - 3'

Adenine (A) always pairs with thymine (T) with two hydrogen bonds and Guanine (G) always pairs with Cytosine (C) with three hydrogen bonds. DNA double helix show antiparallel strands means if one strand run towards 5' to 3' direction then it's complementary strand run towards 3' to 5' direction.

Ans.3- DNA replication occurs during Synthesis ( S phase) of the interphase of cell cycle. Interphase ( S phase ) is the stage when DNA replication occurs. Both mitosis and meiosis contains only one interphase that means DNA replicates once in either mitosis or meiosis.

Ans.4- A primer is a short nucleic acid sequence that provides starting point for DNA synthesis. DNA replication process require primer to extend their strands. DNA polymerase uses primer for DNA synthesis because they cannot replicate DNA template without primers. Hence, the process of DNA replication cannot be initiated without primer. Primers are the complementary to the existing DNA template strand.


Related Solutions

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3'   T A C C G A T G G    5'
Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...
Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...
Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’
1, DNA polymerase a. adds new nucleotides to a strand. b. proofreads DNA strands to see...
1, DNA polymerase a. adds new nucleotides to a strand. b. proofreads DNA strands to see that they are correct. c. makes rare mistakes resulting in mutation. d. is an enzyme. e. is all of thes 2.The three “stop” codons cause what to happen? a. They cause the ribosome to stop building a protein. b. They instruct ribosomes to build proteins. c. They initiate DNA replication. d. They code for three amino acids. 3 True-False. Messenger RNA is the same...
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')
learn how to find the nucleotide sequence of the complementary DNA STRAND
learn how to find the nucleotide sequence of the complementary DNA STRAND
7.Review the structure of DNA. What is meant by a double-stranded structure with complementary anti-parallel strands?...
7.Review the structure of DNA. What is meant by a double-stranded structure with complementary anti-parallel strands? 8. What is the difference between replicating the leading strand and the lagging strand? 9. What is the role of each of the following in DNA replication: origin of replication, helicase, single-strand binding proteins, primase, DNA polymerase III, DNA polymerase I, ligase, and topoisomerase, Okazaki fragments, and telomerase? 10. What problem does the mechanism of DNA replication pose for the ends of linear eukaryotic...
Draw what a parent and daughter strand of DNA would look like before DNA ligase is...
Draw what a parent and daughter strand of DNA would look like before DNA ligase is added to the reaction, but after DNA Poly I was added..
What would happen if there were an error in the DNA complementary base pairing? explain.
What would happen if there were an error in the DNA complementary base pairing? explain.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT