Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand.

3' T A C C G A T G G 5'

Expert Solution

DNA (Deoxyribonucleic acid) act as hereditary material and it carries the genetic information from one generation next generation. From generation to generation species identity is maintained by the DNA & the genes are segments of the DNA that codes for the proteins. Based on the Chargoff’s rules and X-ray diffraction data of Wilkins and Franklins, the Double helical model of DNA was given by the James Watson and Francis Crick in 1953. They predicted that two polynucleotide chains coil to each other form a right-handed double helix, in which on DNA strand run in 5’ to 3’ direction and other in 3’ to 5’ direction. The first DNA strand whose sequence complementary to the mRNA is called template DNA strand or negative DNA strand or nonsense DNA strand and the DNA strand whose sequence is similar to the mRNA, that DNA strand is known as a coding strand or positive DNA strand or sense strand.

3’-TACCGATGG -5’ (template DNA strand)- given in the question

5’-ATGGCTACC-3’ (non-template DNA strand)

gladiator answered 1 year ago

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...

Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’

learn how to find the nucleotide sequence of the complementary DNA STRAND

1. What would the complementary strand of DNA be for these strands of DNA? (1 point...

1. What would the complementary strand of DNA be for these strands of DNA? (1 point each; 5 points total) a. 5’ – AGCTTGCATGGCTATT – 3’ b. 3’ – GCAATGGGCGCT – 5’ c. 3’ – AAATCCGATGCGCTA – 5’ d. 5’ – GCAGCAGCATTGCA – 3’ e. 3’ – GCAATCGCCGGTGCAC – 5’ 3 During what portion of the cell cycle does DNA replicate? How many times does DNA replicate before mitosis? How many times does DNA replicate before meiosis? (3 points) 4...

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA...

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA sequence of the DNA strand above and what is the amino acid sequence? If you have an RNA transcript that is 100 bp, how many codons does it contain? If you take the template DNA that is shown in question 1 and you mutate the 6thnucleotide from A to G how does that impact the polypeptide sequence Is it better to have a mutation...

The sequence below represents the coding DNA strand of the start of a gene, including part...

The sequence below represents the coding DNA strand of the start of a gene, including part of the 5' untranslated region. (5')...TCGGAAGGAGGTAGCGGCAATGGGGAAAAGTATTGCTT...(3') In studying variants of this gene in disease, a nucleotide mutation of A→T was detected in the first base of the third codon. What effect would this mutation have? (When considering your answer, assume standard initiation of translation is numbered as codon 1.) Select one: a. Terminates translation b. No effect c. Disrupts ionic interactions at physiological pH...

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’...

Below is a DNA sequence of Borrelia burgdorferi containing the sequence of one strand only. 5’-ACTTCAGGATCCACTGGGCCCGAATTCGTCCTGAGCTCTAGAGTCCTTCG-3’ A) Please make the DNA double stranded by writing the complementary strand of the DNA underneath the strand above. B) Find in internet restriction sites for BamHI, EcoRI and XbaI. Please place a box around each restriction site in the DNA. C) You choose to cut this DNA with all three restriction enzymes. How many DNA fragments will you get? D) You choose to cut...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

Question