Question

In: Biology

how to find the complementary genomic sequence of this oligonucleotides, please explain how to do find...

how to find the complementary genomic sequence of this oligonucleotides, please explain how to do find it.

Oligo 1 5’-CGCTAGGATCGAACCATACTCGGAC-3’

Oligo 2 5’-CATAGAATTTACGCATACCTAAGAT-3’

Oligo 3 5’-TACGTACGTACGCGTACGTACGTA-3’

Solutions

Expert Solution

Complementary genomic sequence of oligonucleotides means that we need to construct another oligonucleotide that will pair with the one in the question. This pairing occurs by following certain rules.
Purines (such as Adenine and Guanine) bind with Pyrimidines (such as Thymine and Cytosine) and as such in a specific order. So A binds with T, T with A, C with G, and G with C.
To construct the complementary genomic sequence of this oligonucleotides, simply write down the corresponding complementary alphabet in its place.
A -> T
T -> A
C -> G
G -> C

Since the strands in the question run from 5' to 3' direction, the resulting complementary strand needs to run in the opposite direction:

Oligo 1
5’-CGCTAGGATCGAACCATACTCGGAC-3’
3’ - GCGATCCTAGCTTGGTATGAGCCTG - 5’ (ANSWER)
Oligo 2
5’-CATAGAATTTACGCATACCTAAGAT-3’
3’ - GTATCTTAAATGCGTATGGATTCTA - 5’ (ANSWER)
Oligo 3
5’-TACGTACGTACGCGTACGTACGTA-3’
3’ - ATGCATGCATGCGCATGCATGCAT - 5’ (ANSWER)


Related Solutions

learn how to find the nucleotide sequence of the complementary DNA STRAND
learn how to find the nucleotide sequence of the complementary DNA STRAND
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
If a sequence of one strand of DNA is ATTGCTCG, what is the complementary sequence?
Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of...
Explain the basis of complementary base paring. Given the nucleotide sequence of a single strand of DNA (below), write the sequence of the complementary strand indicating the appropriate 5' and 3 " ends.
2) Additional experiments confirmed that the difference in sequence between the expected genomic sequence and the...
2) Additional experiments confirmed that the difference in sequence between the expected genomic sequence and the experimentally determined cDNA sequence is neither due to a replication error nor to a DNA sequencing mistake. One of your coworkers decided to perform 5 independent experiments. In each experiment, the gene was first transcribed and then the transcript was purified and reverse- transcribed to produce double stranded cDNA copies of the gene. Finally, one copy of synthesized cDNA from each independent experiment was...
Discuss a) Genomic and complementary DNA (cDNA) libraries and b) The testing of pharmaceutical drugs.
Discuss a) Genomic and complementary DNA (cDNA) libraries and b) The testing of pharmaceutical drugs.
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown...
Write down the DNA base sequence that is the complementary strand to the DNA sequence shown below? (5') C G A C T T C G A G C T (3')
Compare the functions of the mooring sequence (C to U editing), the exon complementary sequence (A...
Compare the functions of the mooring sequence (C to U editing), the exon complementary sequence (A to I editing), and guide RNA (pan-editing).
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....
Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3'   T A C C G A T G G    5'
how to find arithmetic sequence, geometric sequence, and fibonacci sequence on excel?
how to find arithmetic sequence, geometric sequence, and fibonacci sequence on excel?
How do you find the complementary solution of a nonhomogeneous differential equation? Could someone give me...
How do you find the complementary solution of a nonhomogeneous differential equation? Could someone give me a general rule or few rules to find the complementary solution based on the appearance of the given equation or the roots of the given equation? Thanks
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT