the following questions refer to homeostasis.
a) you have just completed your first ironman (a very, VERY strenuous event). you are very hot since this is a very intense race. DESCRIBE ALL THE CHANGES that would occur in your body to restore homeostasis. is this a negative or positive feedback loop? explain. no diagrams please explain thoroughly.
b) describe thoroughly how exactly the endocrine system works and helps to keep the body at homeostasis. no diagrams please explain thoroughly.
In: Biology
2. (6 pts) Speculate on the effects of each of the following mutations on the translation of the following mRNA. Specifically indicate whether any product would be made, and if so, if it would be altered in any way. (GpppG is the 5’ cap)
5’GpppGUAACAUGGUCGGACCAUGAC(A)2003’
In: Biology
a. Tetracycline is a common medication used to treat bacterial infections. It prevents the aminoacyl-tRNA from binding to the ribosomal subunit. Describe the effect on the cell.
b. The wobble hypothesis predicts that fewer than 61 tRNA molecules are required to read the 61 sense codons. State the minimum number required. Explain.
In: Biology
10.During protein degradation, a polypeptide chain is broken down into individual amino acids. Which of the following is false about this process?
a.It is an exergonic reaction.
b.The products have lower disorder than the reactants.
C.The products have lower free energy than the reactants
D.It is a catabolic process.
E.It is catalyzed by enzymes.
12.You quantitatively determine that an enzyme-catalyzed reaction has a ΔG of -8 kcal/mol. If you half the amount of enzyme in the reaction, what will be the ΔG of this reaction?
A.16 kcal/mol
B. -4 kcal/mol
C. 0 kcal/mol
D. 8 kcal/mol
E. -8 kcal/mol
18. Hemoglobin is a protein responsible for transporting oxygen in the blood of vertebrates. Carbon dioxide binds to hemoglobin at a distinct site from where oxygen binds. However, CO2 binding causes a conformational change in hemoglobin that decreases the protein’s binding affinity for O2. What kind of interaction does this describe?
A. catalyzed interaction
B. covalent binding
C. competitive interaction
D. irreversible interaction
E. allosteric interaction
19. Which of the following states the relevance of the first law of thermodynamics to biology?
A. Photosynthetic organisms produce energy in sugars from sunlight.
B. The total energy taken in by an organism must be greater than the total energy stored or released by the organism.
C. Living organisms must increase the entropy of their surroundings.
D. Energy is destroyed as glucose is broken down during cellular respiration.
E. Energy can be freely transformed among different forms as long as the total energy is conserved.
22. An artificial liposome (ie, a test-tube created vesicle), whose membrane contains no proteins and whose interior is filled with water is dropped into a beaker of 0.03 M sucrose solution (Note: Sucrose is a disaccharide). Which best describes what will quickly happen?
A. Sucrose will diffuse into the liposome.
B. The liposome will shrink as water leaves this vesicle.
C. Since there are no membrane proteins, nothing will cross the membrane.
D. Water will diffuse into the liposome, causing it to burst.
E. Sucrose will diffuse out of the liposome.
In: Biology
In: Biology
In cellular respiration, the energy begins in glucose. Glucose is then converted to other molecules and its energy is stored in other molecules. For each of the 4 steps of cellular respiration, list which molecule contains most of glucose’s energy at the end of that step.
In: Biology
Why might certain foods be more satiating/have a higher satiety index than others, regardless of time of day eaten? Give your overall conclusion on the information presented regarding time of day (and day of the week, such as changes on weekends) on satiety and an overall healthy diet/eating plan.
In: Biology
In: Biology
a. A single-celled freshwater protist is placed into a beaker of salt water.
b. A salt-water snail is mistakenly put into a freshwater tank.
c. A head of lettuce is placed soaked in a sink of salt water.
d. A bunch of carrots are placed soaked a sink of distilled water.
3. Some gardeners kill slugs by pouring salt on them. Given what you have learned about osmosis, explain why this method is effective.
In: Biology
Regarding the ABCD Method of Nutrition Assessment, when might the assessment of body mass index (BMI) be problematic? When might assessments of dietary intake by registered dietitians be problematic?.
How beneficial do you think that phytochemicals and zoochemicals are, whether in their source functional food or added to another food (different that fortifying a food with a nutrient), or even in a pill as a supplement?.
In: Biology
1. A signaling molecule . . (choose the best answer)
A. Will produce the exact same effect on all cell types it interacts with
B. Could be a hormone or neurotransmitter
C. Will not elicit changes in gene expression
D. Is never water soluble
E. Must travel through the bloodstream to its target cell
2. Insulin . . (choose all that apply)
A. Is antagonistic to Glucagon
B. Is produced by the pancreatic beta cells
C. Triggers storage of glycogen in the liver
D. Promotes release of glucose from the pancreas
E. Is a hormone
3. The posterior pituitary and anterior pituitary are different in which of the following ways? (choose all that apply)
A. The posterior pituitary makes its own hormones
B. The anterior pituitary makes its own hormones
C. The anterior pituitary makes TSH to stimulate the Thyroid
D. The posterior pituitary gland does not affect mammary glands
4. The hypothalamus . . (choose all that apply)
A. Is a nerve center
B. Releases neurohormones
C. Affects the pituitary gland to release hormones
D. Is an example of how the 2 control and communicate mechanisms often work together
5. The action potential of a neuron . . (choose all that apply)
A. Can travel either way through the axon
B. Is caused by an influx of Na ions
C. Is a massive change in voltage on the membrane
D. Can be slowed by myelin insulation
In: Biology
1.A scientist is studying a human disorder that may be attributable to a mutation in the mitochondrial DNA. Based on what evidence the scientist believes this
A. Specific genetic mutation is observed
B. A rare parasitic disease is associated with his disorder
C. Maternal rather than Mendelian inheritance pattern is observed
D. The ATP production is affected
2.Eukaryotic and bacterial DNA replication share many features, but eukaryotic DNA replication is more complex. What features of eukaryotic DNA replication are not shared with bacteria?
A.Linear chromosomes
B. All answers are correct
C. DNA complexed with nucleosomes
D. Eukaryotic chromosomes contain multiple ORIs
3. Bacterial transformation involves DNA transfer to a recipient cell
A.By sexual reproduction
B.As naked DNA in solution
C.By cell-to-cell contact
D.By a bacteriophage
4. Mutations in the mitochondrial DNA can cause human disorders. What future approach involving nuclear transplantation might be available to treat mtDNA-based human disorders?
A.Mitochondrial swapping
B.Nuclear disintegration
C.Mitochondrial suppression
D.Nuclear Activation
5. During DNA replication
A. The two DNA strands separate, each strand then becomes a template for the assembly of a similar strand. Each new DNA helix has one old strand with one new strand.
B. The two DNA strands separate, each strand then becomes a template for the assembly of a similar strand. Each new DNA helix has two new strands.
C. The two DNA strands separate, each strand then becomes a template for the assembly of a complementary strand. Each new DNA helix has one old strand with one new strand.
D. The two DNA strands separate, each strand then becomes a template for the assembly of an identical strand. Each new DNA helix has one old strand with one new strand.
6. What is the function of RNA primase in DNA replication?
A.Provides a DNA primer
B. synthesizes RNA primer that provides a free 5′-OH upon which DNA
polymerization depends
C. provides a free 3′-OH upon which DNA polymerization depends
D.
|
provides a free 5′-OH upon which DNA polymerization depends |
In: Biology
Please describe stutter. How does it happen (mechanism)? How can it affect DNA interpretation
In: Biology
|
2. a) Traditional therapy in APL includes pharmacological concentration of retinoic acid (ATRA) and chemotherapy. What is the function of the chemotherapy component in this treatment protocol?
|
||||
b) A laboratory professional is reviewing a peripheral blood smear of a 10-year-old patient and notes that 35% blasts are present. Which of the following diagnoses is likely based on these findings?
|
Aplastic anemia |
|
Acute leukemia* |
|
Myelodysplastic syndrome |
|
Chronic myeloid leukemia |
c) A 45-year-old female was evaluated by her physician because she had unexplained bruising on her upper torso. Patient history was unremarkable. Physical examination revealed a palpable liver and spleen. CBC results revealed: WBC count: 12 × 109/L Hb: 8.7 g/dL Hct: 25% Normal indices PLT count: 5 109/L Differential: 80% blasts and 15% promyelocytes present Bone marrow findings: hypercellular marrow with 47% myeloblasts present. Nucleated erythroblasts: 22%; promyelocytes: 28%; megakaryopoiesis appears normal. Cytogenetic analysis: t(15, 17) present.What is the most likely diagnosis?
|
AML without maturation |
|
APL |
|
AML minimally differentiated |
|
AMML |
d) According to the WHO classification, when differentiating myelodysplastic syndromes and acute leukemia, acute leukemia's:
|
Blasts must be >20% in the bone marrow* |
|
Bone marrow must contain fibrosis |
|
Blast count is close to 100% |
|
Blasts must be >20% in the bone marrow and contain Auer rods |
e) A patient presents with bleeding and is found to be in DIC. The peripheral smear contains hypergranular promyelocytes. The white count is slightly elevated. The bone marrow contains cells with multiple Auer rods with a clear blue cytoplasm. What is the probable type of AML?
|
Microgranular APL variant |
|
AML with 11q23 abnormalities |
|
AML with multilineage dysplasia |
|
AML with t(15;17) q22;q12)* |
Clear explanation and legible handwriting
In: Biology
How is the life of a sessile biofilm cell different than the same cell when it is planktonic - relative to nutrients, attachment, resistance to antimicrobial conditions, both physical and chemical?
In: Biology