A man heterozygous at both the locus for PTC tasting and at the locus for albinism marries an albino woman heterozygous at the PTC tasting locus. These two loci assort independently. a) what is the probability of producing 3 tasters with normal pigmentation and 3 non-taster albinos in a family of 6 children? b) what is the probability of producing 3 tasters with normal pigmentation and 3 non- taster albinos in that order in a family of 6 children?
In: Biology
Describe at least two elements from a food label of something you currently eat. that you feel will be of great significance in planning a healthy eating plan for yourself, examine the focus panel comparing the old standard FDA mandated food label for most packaged foods with the then-proposed new one. Compare the old to the new one in reality that you are holding. Identify at least two distinctions between your label and the old label in the picture; tell if those distinctions changed in the same way as predicted in the picture or in a different way, and why this might be important. Lastly, regarding the 'Ingredients', do you think in general that a healthier food will have a longer or shorter list? Why?.
In: Biology
For each of the three amphibian groups Caudata, Anura and Gymnophiona
generally summarize how they reproduce (calling? internal? external? eggs? metamorphosis? direct development etc., any parental care?).
In: Biology
8. Large chromosome rearrangements or duplications are a common feature of cancers, but not of inherited genetic traits.
8A. Explain why these types of mutations are not tolerated in live births. 4 pts)
8B. Explain why these types of mutations are common in cancers. (4 pts)
In: Biology
You are planning to use PCR to amplify several regions of a piece of DNA. The sequence of your template DNA is provided below along with the sequences of all available primers. Determine where each of the primers bind and answer the following:
5' AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3'
3' TCCCGGTTTACTCTACTCAGTTTTCGACGGCTATTGGCCTATC 5'
Primer 1: 5-TTGGCC 3
P2: 5-GTCAAA-3
p3: 5-AACCGG-3
p4: 5-CCGGTT-3
P1 can bind to the bottom strand?
P4 can bind to the molecule at only one location
Which primer pair would you use to amplify a double stranded pcr fragment of any size from this template
Which primer has the lowest melting point
Using the two selected primers and added all of the PCR components to a test tube answer the following as the polymerase chain rxn proceeds
The concentration of dNTPs will increase,decrease, stay the same, as the rxn proceeds
The concentration of Taq DNA polymerase will increase,decrease, stay the same, as the rxn proceeds
In: Biology
Define selective agar
Explain in detail how SS agar is selective.
SSA is also a differential agar.
Define differential agar
Explain in detail the two way that SS agar is
differential.
Describe the colonies of the following bacteria species:
Salmonella -
Shigella -
Proteus -
E. Coli –
In: Biology
Describe the pathway of a H2O molecule from the soil solution from its absorption by a root hair to its exit to the atmosphere from a stomate 100 meters above the forest floor. Be sure to mention all tissues and cell types that it may pass through, their significance, as well as any relevant physical forces acting upon it.
In: Biology
1. Which of the following statements about beta diversity is TRUE?
A. Beta diversity does not change when you measure it at different scales
B. All else being equal, generalists are more likely to be common when beta diversity is high
C. Homogenous landscapes tend to have high beta diversity
D. Topographically diverse, heterogenous landscapes tend to have high beta diversity
2.
Which of the following statements about species-accumulation curves is TRUE?
A. Only gamma diversity can be estimated using species-accumulation curves
B. Species-accumulation curves are a technique to estimate alpha diversity of a relatively homogenous site
C. Species richness will be estimated correctly using species-accumulation curves even if there are only a few samples
D. The order in which samples are processed will not affect the precise shape of species-accumulation curve
In: Biology
Use the chi-square test for goodness of fit to determine if the data shown below are consistent with an inheritance pattern of simple dominance. Use p = 0.05 for determining significance.
Cross: Aa x Aa
Offspring:
70 dominant phenotype
30 recessive phenotype
A. The data are consistent with a simple dominance pattern of inheritance.
B. The data are not consistent with a simple dominance pattern of inheritance.
In: Biology
Attachment of myelin to the surface of some neurons occurs via the interactions of transmembrane adhesion molecules expressed on the myelin membrane with receptors on the target axons. Several human peripheral neuropathies are associated with mutations in genes encoding theses myelin-associated proteins that disrupt myelin-axon attachment, (1) Explain the symptoms this loss of peripheral myelination might be expected cause and why, given the function of myelin in the nervous system. (2) Propose a hypothesis to explain why only peripheral and not central nervous system symptoms are observed in these diseases.
In: Biology
Since enzymes are essential in cellular function – it’s important to regulate their activity. There are several ways a cell can accomplish such regulation. How do cells regulate enzyme activity? (required minimum length 150 words)
In: Biology
2. ABO Serologic testing for the antigens on the red blood cells is known as:
_ _ _ _ _ _ _ or _ _ _ _ _ or Cell typing
2. Serological testing for the non-red blood cell stimulated (naturally) occurring ABO antibodies in the patient serum/plasma which are permitted to react with commercial reagent red blood cell suspensions (3-5% for tube and 0.8% for gel) of known A1 antigen red blood cells and B antigen red blood cells.
This is known as: _ _ _ _ _ _ _ or _ _ _ _ typing
In: Biology
The ____________, which is region closest to the neural tube lumen contains mostly neural stem cells. a. Ventricular zone b. Mantle c. Marginal zone d. All of the above
In: Biology
The role of Voltage Sensitive Na+ Channels (VSSC in neuron signaling) is:
a) Initiation of depolarization
b) propagation of depolarization
c) space from an axonal membrane of a neuron to dendrite membrane of next neuron
d) release of neurotransmitter
ATP production during aerobic respiration is by which mechanism:
a) substrate level phosphorylation
b) oxidative-phosphorylation
c) both substrate-level and oxidative-phosphorylation
d) This depends upon the temperature
e) this depends upon the pH
ATP production during glycolysis is by which mechanism:
a) substrate-level phosphorylation
b) oxidative-phosphorylation
c) both substrate-level and oxidative-phosphorylation
d) this depends upon the temperature
e) this depends upon the pH
Which is not a postulate of cell theory:
a) all life is made of cells
b) heredity is controlled by genes
c) all cells come from pre-existing cells
d) all cells are microscopic
If a molecule has a molecular weight (mw) of 3,685 daltons (Da), then how many grams are required to make 1.0 mole:
a) 3,685 g
b) 368.5 g
c) 36.85 g
d) 3.7 g
In: Biology
Which of the following correctly matches a component of the cytoskeleton to one of its functions?
a. intermediate filaments contribute to cytoplasmic streaming
b. microtubules move chromosomes during cell division
c. microtubules help muscle cells contract
d. microfilaments form channels called plasmodesmata
e. microfilaments cause ciliary bending
In: Biology