I need an essay about 300 words for this topic : DNA Secret of Photo 51

Sickle-cell anemia is an interesting genetic disease. Normal homozygous individuals (SS) have normal blood cells that are easily infected with the malarial parasite. Thus, many of these individuals become very ill from the parasite and many die. Individuals homozygous for the sickle-cell trait (ss) have red blood cells that readily collapse when deoxygenated. Although malaria cannot grow in these red blood cells, individuals often die because of the genetic defect. However, individuals with the heterozygous condition (Ss) have some sickling of red blood cells, but generally not enough to cause mortality. In addition, malaria cannot survive well within these "partially defective" red blood cells. Fitness of different genotypes is as follows: 50% of the SS individuals survive and reproduce; 100% of the Ss individuals survive and reproduce while only 5% of the ss individuals survive and reproduce. Thus, heterozygotes tend to survive better than either of the homozygous conditions. If 9% of an African population is born with a severe form of sickle-cell anemia (ss), what percentage of the population will be more resistant to malaria in the second generation because they are heterozygous (Ss) for the sickle-cell gene?

Please note it is asking for the second generation! not the first!!!!

Homo erectus (Anthropology)

1. Describe the physical characteristics of Homo erectus. How does this species compare to earlier hominins and to modern humans (Homo sapiens)?
2. Explain why losing body hair and being able to sweat may have given hominins an advantage.

Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in the cytoplasm: Select one:

a. 5’ AUGGCCCGGAAACAAAAAAAAAAAAAAAAAAAAAAA 3’ b. 5’GTCACGATCGACTAGATCGACTGACTGACTGCTAGCATACTACTAAAAA 3' c. 5’ GCUAUAACGUGGAAAAAAAAAA 3’ d. 3’GCUCCUCUAUCACUCUACUAAACAAAACAAGUAAAAAAAAAAAAAAAAAAA 5’

What is your favorite food? Use proper terms to describe its sensory aspects. Which sensory attributes agrees with your taste? Which sensory attributes do you use to judge the quality of this food? What sensory aspects in this food can tell if this food has gone bad? You can use pictures to support your answer.

1. Describe how attaching an enzyme to the cell membrane regulates the rate of a specific reaction

2. Describe the type of reaction that is typically regulated by an allosteric enzyme based on DG for the reaction.

3. Differentiate between positive and negative feedback loops based on sequence of reactions resulting the formation of a final product, “F”

4. Differentiate between the [S] that gives half maximum velocity based on an allosteric enzyme without and with an allosteric activator

Question 30:

A. Describe the secondary structural characteristics of B-form double-stranded DNA.

B. Explain how to determine the number of supercoils present in a molecule of DNA.

C. Explain/demonstrate how to determine changes in linking number for DNA.

Topic : recent advance in Genetics ( write a review on it more than 800 words) Please answer the question only if you can observe the minimum limit of 800 words. Thank you

What is the main purpose of chromosome pairing in meiosis I?

Group of answer choices

For crossing over to occur

For proper chromosome segregation to occur

For mitosis to occur

Flag this Question

Question 291 pts

Male bees are haploid. How do they produce gametes?

Group of answer choices

By mitosis

By meiosis

Flag this Question

Question 301 pts

Which of the following determines the correct segregation of X and Y chromosomes during meiosis I in humans (males):

Group of answer choices

Lack of homology between X and Y

Presence of “pseudoautosomal” (PAR) regions shared by X and Y

The presence of the SRY gene

Answer the following questions in at least two paragraph (Be as descriptive as possible)

Compare the structure of DNA and RNA. Explain how the structure of tRNA correlates to its function? Discuss any versatility or redundancy that is present?

When a heterozygous Aa diploid cell undergoes mitosis, what are the genotypes of the mitotic products?

Group of answer choices

Aa (product 1) and Aa (product 2)

AA (product 1) and aa (product 2)

AA (product 1) and AA (product 2)

aa (product 1) and aa (product 2)

When a heterozygous Aa diploid cell undergoes the 1^st meiotic division (meiosis I), how will the A and a alleles distribute to the two meiosis I products if there is no crossing over?

Group of answer choices

Aa (product 1) and Aa (product 2)

AA (product 1) and aa (product 2)

AA (product 1) and AA (product 2)

aa (product 1) and aa (product 2)

According to Mendel’s principle of segregation, an Aa heterozygous diploid organism produces:

Group of answer choices

Only gametes that are AA

Only gametes that are aa

AA and aa gametes in theoretically equal numbers

A and a gametes in theoretically equal numbers

According to Mendel’s principle of independent assortment, a diploid organism with the genotype Aa Bb (the genes are located on different chromosomes) produces:

Group of answer choices

Only Ab and aB gametes

Only ab and AB gametes

AB, Ab, aB, and ab gametes

If allele A confers the A⁺ phenotype, and allele a is recessive (aa has A^- phenotype), what will the A⁺ : A^- ratio be among the offspring of an Aa X Aa cross?

Group of answer choices

1A⁺ : 1A^-

1A⁺ : 3A^-

3A⁺ : 1A^-

4A⁺ : 0A^-

Why is the interconnectedness of the brain critical to higher order function?

What do both G protein-coupled receptors and tyrosine kinase receptors have in common?

A chromosomally XY fetus with normally functioning testes has a mutation in the androgen receptor so it can't respond to testosterone (but it can still respond to MIS). Which of the following WILL develop by the time the child is born?

Select one:

a. A uterus

b. Fallopian tubes

c. A cletoris

d. An epididymis

What important difference appears to explain why some species form pair bonds and others don't?

Select one:

a. Species differences in the size of the nucleus accumbens

b. Species differences in the number and/or distribution of oxytocin and vasopressin receptors in the brain

c. Species differences in the circulating concentrations of oxytocin and vasopressin