Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in...

Which of the following eukaryotic sequences would you predict to have the longest “life-time” (stability) in the cytoplasm: Select one:

a. 5’ AUGGCCCGGAAACAAAAAAAAAAAAAAAAAAAAAAA 3’ b. 5’GTCACGATCGACTAGATCGACTGACTGACTGCTAGCATACTACTAAAAA 3' c. 5’ GCUAUAACGUGGAAAAAAAAAA 3’ d. 3’GCUCCUCUAUCACUCUACUAAACAAAACAAGUAAAAAAAAAAAAAAAAAAA 5’

Solutions

Expert Solution

The eukaryotic sequence that would you predict to have the longest “life-time” (stability) in the cytoplasm is :-

(b) 5’GTCACGATCGACTAGATCGACTGACTGACTGCTAGCATACTACTAAAAA 3'

In the DNA helix, the bases: adenine, cytosine, thymine and guanine are each linked with their complementary base by hydrogen bonding. Adenine pairs with cytosine and guanine pairs with cytosine.

The stability of a sequence depends on the GC content since there are 3 hydrogen bonds between Guanine (G) and Cytosine (C) whereas 2 hydrogen bonds between Adenine (A) and Thymine (T).

The number of GC in sequence (a) is 8 ; in sequence (b) is 21 ; in sequence (c) is 6 and sequence (d) is 12.

Since the sequence (b) contains highest content of Guanine (G) and Cytosine (C).

Thus sequence (b) will have the longest life time (stability) in the cytoplasm.

So the correct answer is (b) 5’GTCACGATCGACTAGATCGACTGACTGACTGCTAGCATACTACTAAAAA 3'

gladiator answered 1 year ago

Next > < Previous

Related Solutions

Which of the following types of business would normally have the longest operating cycle? A. A...

Which of the following types of business would normally have the longest operating cycle? A. A car manufacturer B. A seller of resort property C. A car dealer D. A record store E. A grocery store Which of the following would not be classified as a current asset? A. Investments B. Marketable securities C. Cash D. Inventories E. Receivables Which of the following accounts would not be classified as a current asset? A. Cash and equivalents B. Cash C. Cash...

1) Predict (write the sequences of) the fragments that would be generated from the treatment of...

1) Predict (write the sequences of) the fragments that would be generated from the treatment of the following peptide Gly-Ala-Trp-Asp-Arg-Lys-Ala-Glu- Gly-Phe-Gln with: a) trypsin (4 pnts) b) chymotrypsin c) pepsin 2) A certain protein has an α-helix which is 18 residues long with the sequence shown below. It is known that hydrogen bonding through the backbone H-bond donor/acceptor groups stabilizes most of the structure. Show what other interactions would help stabilize the helix...

Which of the following atoms would you predict to have a fourth-ionization energy very much greater...

Which of the following atoms would you predict to have a fourth-ionization energy very much greater than the third? Na Mg Al Si P

In which of the following cases would you be able to predict with certainty the change...

In which of the following cases would you be able to predict with certainty the change in the equilibrium price? There is more than one answer to this question. You must mark all of the correct answers to receive full credit for this question. There is a decrease in demand. There is a decrease in demand and an increase in supply. There is an increase in demand and an increase in supply. There is an increase in supply. There is...

Which of the following are arithmetic sequences, which are geometric sequences, and which are neither? (a)...

Which of the following are arithmetic sequences, which are geometric sequences, and which are neither? (a) 5, 10, 20, 40, 80, Describe the sequence and the change in it. (b) 3, 8, 13, 18, 23, 28, Describe the sequence and the change in it. (c) 1, 4, 9, 16, 25 Describe the sequence and the change in it.

Which of the following balance sheet items generally takes the longest time to convert to cash?

Which of the following balance sheet items generally takes the longest time to convert to cash? marketable securities accounts payable inventory accounts receivable

Use the following data to predict the wage you would have to pay to hire a...

Use the following data to predict the wage you would have to pay to hire a particular individual. a. Specify a regression equation b. Estimate a regression equation to explain wages c. Explain the t-stats, f-stats, and the R Squared. What information do they give ? d. You have a nonwhite female with 20 years in the industry and an MBA. How much will you have to pay to hire her? What if she was a white male? e. Does...

The steps to creating an information security plan would be in which of the following sequences?...

The steps to creating an information security plan would be in which of the following sequences? Identify threats, identify risks, design controls, incorporate controls into an enterprise-wide plan, Set forth policies Set forth policy, design controls, identify risks, identify threats, incorporate controls into an enterprise-wide plan

In which case below would you predict males to have the largest testes size? a. Mates...

In which case below would you predict males to have the largest testes size? a. Mates are strictly monogamous. b. Females freely mate with multiple males. c. Males closely defend groups of females from other males. d. Males are able to “seal off” the female’s reproductive tract after mating.

Which of the following substances would you predict to be a) most ionic, b) most covalent,...

Which of the following substances would you predict to be a) most ionic, b) most covalent, and c) most metallic? Answer choice #1: a) NaF b) CCl4 (c) Rb Answer choice #2: a) AlCl3 b) SiCl4 (c) Mg Answer choice #3: a) MgO b) PF5 (c) K

Subjects