1. What are the k-mers of length k = 21 for this sequence read in FASTQ...

1. What are the k-mers of length k = 21 for this sequence read in FASTQ format?

@K000384:75:HM57CBBXX:1:1101:25530:1384 1:N:0:GTGGCC

CTGGCACTGGGCTTCAAGCTGGGCTACCTTCTGTTT

+

AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

[please be detailed, thanks]

Expert Solution

Answer-

FASTA format is a text-based format for representing either nucleotide sequencesor peptide sequences, in which base pairs or amino acids are represented using single-letter codes. A sequence in FASTA format begins with a single-line description, followed by lines of sequence data.

FASTA format need to be searched from the NCBI

website

https://www.ncbi.nlm.nih.gov

Then select the search as Nucleotide.

After that paste the sequence to get the FASTA Sequence.

ATTGACAGAACCTTGACCCTGGCCACAGGCTGGGCTCTGCCCTGACTGTGGGTGAGTGGCTTGCTTGGCT
CACCTGGCTGGTGGCTGGGCTGGGTCTCAGTTCAGGTGTGTGTGATTAGGAGGCAGCCATGCAGGACCTT
TTGTTAGTGGCAGAAGAAACTTCAGGGGACAAGGTAGTTGGAAGTGACTGATTTCCCAGCGGGGAGGACT
TCAAGAATGTTCCTTTTCCCAGCTTTGAGTTTCTCTGGGTTGTACTGGGAGAGGCTCTTAGAGAGGTGGG
TGTAGGGAAGGGAGCCCTCTGCCCTCTCTACATCCGTCTCCCGGGGTGGGTCCCAGAGCCCTGGCGGTGG
GGCCCCATGACTCCTCTTGAGCAAAGACTGCAAGTGTCAACTTTTCTAAAGGTGCAGGTTCCCCGTTCAC
TCCAGTTCATCACTGGTTCCTCAAGGGACCACCTGGATTTTATCCTGCTTCAAGTCATCCTAATCCATTC
TCTAATTTGGATCGGGATGTGAGGCTGCTGAGCAAGAGTGGTAAGCCACTTTCTGACCTCATTTCCTCAC
GGGGATAGGTAAGCCTGCCTGTAGACTTGGATGAGAGCAAGTACCTGCACAGGGCTGGGCACAGACAAGG
GACAGTTGCTGTGGGGCTTGACATGAAGTAGTGTGTCACGTATTTTCACTGAACCAGACTCATTACACTC
TGGAGGCTGGCTCAGCATGGAACCTTCTAGAAAGGCAAGGCTCCCACCATACCCAAAGCTATGAGTGGCC
CCATGAGCTGTTTCTGATCTCCAGGCTGGATTGAGACCCAGCCACAACACCAGCTGGACCCTGTCTCCTC
AGTGATTTTCCTAAAGTGTGCTTTCCTAGGCTGGGTGTATGGGGGACAGGGGTCGCAGGGCTGGAGCTTG
GGGGGTGGCAGGTGGCAGGGATGGCTGGAGGGCATGCTGAATGCTCTGAATCCTGACTGCCTTCTCCCTT
TCCGTTTCTGGCCAATCCTGTACTGGCATCTTTCTCCACCGATGGTCCAATTACAGTGCTTGATTACCTG
GACGAAACAATGGAAGGTAGGCCCCCAGACCA

gladiator answered 2 years ago

Question no 1: The d-neighborhood Neighbors(Pattern, d) is the set of all k-mers whose Hamming distance...

Question no 1: The d-neighborhood Neighbors(Pattern, d) is the set of all k-mers whose Hamming distance from Pattern does not exceed d. Generate the d-Neighborhood of a String Find all the neighbors of a pattern. Given: A DNA string Pattern and an integer d. Return: The collection of strings Neighbors(Pattern, d). Sample Dataset ACG 1 Sample Output CCG TCG GCG AAG ATG AGG ACA ACC ACT ACG Question no 2: We say that a k-mer Pattern appears as a substring...

You have 21 cards written from 1 to 21. The number K is inputted from a...

You have 21 cards written from 1 to 21. The number K is inputted from a command window (using input command). First, please shuffle these 21 cards such that the sequence becomes random (using rand command). You need to make a function of New_Cards=shuffle(Orig_Card), where New_Cards is a 1X21 vector that has random sequence of the cards (Ex. New_Cards=[ 14 7 21 6….. 9 1 3 5 8]). When the first even number is greater than K, you should print...

Question 1 A substring of String s is a sequence of k >= 0 characters in...

Question 1 A substring of String s is a sequence of k >= 0 characters in s, in the order in which they occur in s. The letters in a substring may be either contiguous (next to each other) or non-contiguous in the original String s. For instance, these are the substrings of String s="abc". String s All substrings of s ======== ================================== "abc" "" "a" "b" "ab" "c" "ac" "bc" "abc" Write a function allSubstrings that returns an ArrayList...

The Fibonacci sequence 1, 1, 2, 3, 5, 8, 13, 21…… starts with two 1s, and...

The Fibonacci sequence 1, 1, 2, 3, 5, 8, 13, 21…… starts with two 1s, and each term afterward is the sum of its two predecessors. Please write a function, Fib(n), which takes n as the input parameter. It will return the n-th number in the Fibonacci sequence. Using R, the output for Fib(9) should give only the 9th element in the sequence and not any of the previous elements. Please Help :)

For the following sequence read that comes from an internal exon within a gene, what is...

For the following sequence read that comes from an internal exon within a gene, what is the amino acid sequence that is encoded? 5’ TTAAGTAGCCGCTAG 3’

1. Write a program that read a sequence of positive integer inputs and print the sum...

1. Write a program that read a sequence of positive integer inputs and print the sum and average of the inputs. Assume that the user always enters a positive number (integer) as an input value or an empty space as a sentinel value. Please use the below to test your code [45 points]: Enter an int value or empty string to end: 98 Enter an int value or empty string to end: 78 Enter an int value or empty string...

What are the recommendations for monitoring the MERS-CoV virus now and in the future?

For any sequence, S[1…n], of length n, a basement is defined as a contiguous subsequence of...

For any sequence, S[1…n], of length n, a basement is defined as a contiguous subsequence of S, which we denote by S[ i, i + 1, ..., j – 1, j ], with 1 £ i < i + 1 < j – 1 < j £ n, satisfying the following conditions: S[ i ] > S[ i + 1] S[ j – 1] < S[ j ] 1 £ i < i + 1 < j – 1 <...

please read the Two scenarios they are short around a paragraph or two in length read...

please read the Two scenarios they are short around a paragraph or two in length read each scenario and then determine Null and alternative hypthesis then do each of the following. these do not have to be long elaborate answers can be informative and assitive, as I will expand upon ideas and thoughts. Scenario 1 No Worries Cruise Line has started receiving less customers, and they are starting to get worried as to what is happening. A corporate employee, Eddie,...

What is the number of ordered sequences of length k where each digit is taken from...

What is the number of ordered sequences of length k where each digit is taken from a set of size n? What is the number of ordered sequences of length k where each digit is taken from a set of size n without repetition? What is the number of subsets of size k of a set of size n?

Question