1. What are the k-mers of length k = 21 for this sequence read in FASTQ...

1. What are the k-mers of length k = 21 for this sequence read in FASTQ format?

@K000384:75:HM57CBBXX:1:1101:25530:1384 1:N:0:GTGGCC

CTGGCACTGGGCTTCAAGCTGGGCTACCTTCTGTTT

+

AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

[please be detailed, thanks]

Expert Solution

Answer-

FASTA format is a text-based format for representing either nucleotide sequencesor peptide sequences, in which base pairs or amino acids are represented using single-letter codes. A sequence in FASTA format begins with a single-line description, followed by lines of sequence data.

FASTA format need to be searched from the NCBI

website

https://www.ncbi.nlm.nih.gov

Then select the search as Nucleotide.

After that paste the sequence to get the FASTA Sequence.

ATTGACAGAACCTTGACCCTGGCCACAGGCTGGGCTCTGCCCTGACTGTGGGTGAGTGGCTTGCTTGGCT
CACCTGGCTGGTGGCTGGGCTGGGTCTCAGTTCAGGTGTGTGTGATTAGGAGGCAGCCATGCAGGACCTT
TTGTTAGTGGCAGAAGAAACTTCAGGGGACAAGGTAGTTGGAAGTGACTGATTTCCCAGCGGGGAGGACT
TCAAGAATGTTCCTTTTCCCAGCTTTGAGTTTCTCTGGGTTGTACTGGGAGAGGCTCTTAGAGAGGTGGG
TGTAGGGAAGGGAGCCCTCTGCCCTCTCTACATCCGTCTCCCGGGGTGGGTCCCAGAGCCCTGGCGGTGG
GGCCCCATGACTCCTCTTGAGCAAAGACTGCAAGTGTCAACTTTTCTAAAGGTGCAGGTTCCCCGTTCAC
TCCAGTTCATCACTGGTTCCTCAAGGGACCACCTGGATTTTATCCTGCTTCAAGTCATCCTAATCCATTC
TCTAATTTGGATCGGGATGTGAGGCTGCTGAGCAAGAGTGGTAAGCCACTTTCTGACCTCATTTCCTCAC
GGGGATAGGTAAGCCTGCCTGTAGACTTGGATGAGAGCAAGTACCTGCACAGGGCTGGGCACAGACAAGG
GACAGTTGCTGTGGGGCTTGACATGAAGTAGTGTGTCACGTATTTTCACTGAACCAGACTCATTACACTC
TGGAGGCTGGCTCAGCATGGAACCTTCTAGAAAGGCAAGGCTCCCACCATACCCAAAGCTATGAGTGGCC
CCATGAGCTGTTTCTGATCTCCAGGCTGGATTGAGACCCAGCCACAACACCAGCTGGACCCTGTCTCCTC
AGTGATTTTCCTAAAGTGTGCTTTCCTAGGCTGGGTGTATGGGGGACAGGGGTCGCAGGGCTGGAGCTTG
GGGGGTGGCAGGTGGCAGGGATGGCTGGAGGGCATGCTGAATGCTCTGAATCCTGACTGCCTTCTCCCTT
TCCGTTTCTGGCCAATCCTGTACTGGCATCTTTCTCCACCGATGGTCCAATTACAGTGCTTGATTACCTG
GACGAAACAATGGAAGGTAGGCCCCCAGACCA

gladiator answered 1 year ago

Question no 1: The d-neighborhood Neighbors(Pattern, d) is the set of all k-mers whose Hamming distance...

Question no 1: The d-neighborhood Neighbors(Pattern, d) is the set of all k-mers whose Hamming distance from Pattern does not exceed d. Generate the d-Neighborhood of a String Find all the neighbors of a pattern. Given: A DNA string Pattern and an integer d. Return: The collection of strings Neighbors(Pattern, d). Sample Dataset ACG 1 Sample Output CCG TCG GCG AAG ATG AGG ACA ACC ACT ACG Question no 2: We say that a k-mer Pattern appears as a substring...

Question 1 A substring of String s is a sequence of k >= 0 characters in...

Question 1 A substring of String s is a sequence of k >= 0 characters in s, in the order in which they occur in s. The letters in a substring may be either contiguous (next to each other) or non-contiguous in the original String s. For instance, these are the substrings of String s="abc". String s All substrings of s ======== ================================== "abc" "" "a" "b" "ab" "c" "ac" "bc" "abc" Write a function allSubstrings that returns an ArrayList...

For the following sequence read that comes from an internal exon within a gene, what is...

For the following sequence read that comes from an internal exon within a gene, what is the amino acid sequence that is encoded? 5’ TTAAGTAGCCGCTAG 3’

What are the recommendations for monitoring the MERS-CoV virus now and in the future?

For any sequence, S[1…n], of length n, a basement is defined as a contiguous subsequence of...

For any sequence, S[1…n], of length n, a basement is defined as a contiguous subsequence of S, which we denote by S[ i, i + 1, ..., j – 1, j ], with 1 £ i < i + 1 < j – 1 < j £ n, satisfying the following conditions: S[ i ] > S[ i + 1] S[ j – 1] < S[ j ] 1 £ i < i + 1 < j – 1 <...

please read the Two scenarios they are short around a paragraph or two in length read...

please read the Two scenarios they are short around a paragraph or two in length read each scenario and then determine Null and alternative hypthesis then do each of the following. these do not have to be long elaborate answers can be informative and assitive, as I will expand upon ideas and thoughts. Scenario 1 No Worries Cruise Line has started receiving less customers, and they are starting to get worried as to what is happening. A corporate employee, Eddie,...

1. Using 3 nucleotides, adenine, guanine, and cytosine, illustrate why the sequence in DNA is read...

1. Using 3 nucleotides, adenine, guanine, and cytosine, illustrate why the sequence in DNA is read from 5’--------?3’. Draw the structures of the linked nucleotides to illustrate your answer. 2. Draw the structure of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoinositol. Using the drawing, illustrate the difference between saturated and unsaturated fatty acids: 16:0 and 18:1, n-9. 3. Discuss how the structure of the cell membrane regulates the passage of material in and out of the cell. To answer this question, list and draw the components...

What is the number of ordered sequences of length k where each digit is taken from...

What is the number of ordered sequences of length k where each digit is taken from a set of size n? What is the number of ordered sequences of length k where each digit is taken from a set of size n without repetition? What is the number of subsets of size k of a set of size n?

What occurs on Dec. 21, March 21, June 21, and Sept. 21? What specific names are...

What occurs on Dec. 21, March 21, June 21, and Sept. 21? What specific names are given to these dates? Distinguish between the milky way and The Milky Way. Every star (including the sun) we see by eye or telescopes belongs to the MWG. What does this mean? What are the only things we observe not in our MWG? About how many stars are in the MWG? About how many galaxies are there? What do we conclude about the shape...

Regarding the trp operon leader sequence: 1.What would happen if the leader sequence was mutated in...

Regarding the trp operon leader sequence: 1.What would happen if the leader sequence was mutated in region 3, such that the it was missing? 2. Regarding Electrophoresis: Restriction endonuclease (why restricted?, why endo? Why -nucl-? Why - ase?) RFLP Ethidium Bromide Probe 3. DNA is ___________________ charged and therefore moves toward the _______________ electrode.

Question