Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3' Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3' Design a splint oligomer and write the all-possible content(s) needed...

Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3'

Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'

Design a splint oligomer and write the all-possible content(s) needed for reaction to occur.

Expert Solution

Splint Oligomers: These are the nucleotide sequences that are use to join two consecutive sequences. This is an in-vitro approach where two double stranded break DNA strands are joined using these oligomers.

The rquired components are:

A DNA double stranded break strand
A synthetic Splint oligomer
Polynucleotide kinase
Radio labeled P32ATP
T4 DNA ligase

Here the minimum sequence of splint oligomer that is required is tetramer but it should have few G:::C base pairing as it is important for splint oligomer to hold the two sequence tightly together. As G:::C provide strong bonding.

Splint sequence:

Sequence 1: Sequence 2: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3' 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'

3' CGATCAATCTAGCG5' Splinter oligomer

First the Polynucleotide kinase will add the Radio labeled P32ATP at 5' end of 5'ATCGCTAGG (Sequence 2).

This will proceed by the phosphate diester bond of attack of radio labeled P32ATP at 5' end of 5'ATCGCTAGG by the nucleophilic 3'-OH end of sequence 1.

The DNA ligase fill facilitate the bond formation.

We were unable to transcribe this image

gladiator answered 1 year ago

Please write in multisim: Design 3 bit a synchronous counter to produce the following sequence: 0, 1, 2, 5, 3 then 0.by using...

Please write in multisim: Design 3 bit a synchronous counter to produce the following sequence: 0, 1, 2, 5, 3 then 0.by using J-K Filp Flop.. Please i need in multisim and Step of solution. Thanks!!

For the following exercises, write a recursive formula for each arithmetic sequence. a = {−1, 2, 5, ... }

For the following exercises, write a recursive formula for each arithmetic sequence.a = {−1, 2, 5, ... }

Write and upload a MATLAB script to do the following. Compute the sequence S(n+1) = (2...

Write and upload a MATLAB script to do the following. Compute the sequence S(n+1) = (2 – K) S(n) – S(n-1) ; Assume S(1) = 0, S(2) = 1; (a) Case 1, Assume K = 1 (b) Case 2, Assume K = 2 (c) Case 3, Assume K = 4 Plot all of these on the same plot, for N = 1 to 20

Write RTL code to design a sequence generator which will generate the sequence : 0,0,1,0,1,1 and...

Write RTL code to design a sequence generator which will generate the sequence : 0,0,1,0,1,1 and repeat . (FSM shouldn't be used in RTL)

Show that the probability that all permutations of the sequence 1, 2, . . . ,...

Show that the probability that all permutations of the sequence 1, 2, . . . , n have no number i being still in the ith position is less than 0.37 if n is large enough. Show all your work.

Write a recursive formula for the arithmetic sequence −2, −7/2 , − 5, −13/2 , … and then find the 22nd term.

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures? 2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and...

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5’ and 3’ polarity. Change the font (where it says paragraph above) to "preformatted" to get a constant-width font the will make your sequence more readable. (3 pts) Use the genetic code to write the N to C sequence of the protein specified by this RNA. Remember that the...

Pell's sequence is the following infinite sequence: 0, 1, 2, 5, 12, 29, 70, 169, 408,...

Pell's sequence is the following infinite sequence: 0, 1, 2, 5, 12, 29, 70, 169, 408, 985, 2378 ... first element is 0, the second is 1 and each remaining element is the sum of twice the previous element plus the element before the previous one. (a) Write a function that receives an integer and return the Pell number in that position. By For example, if the input is 2, the output must be 1, if the input is 5,...

Since {1, 2, . . . , 6} is the set of all possible outcomes of...

Since {1, 2, . . . , 6} is the set of all possible outcomes of a throw with a regular die, the set of all possible outcomes of a throw with two dice is Throws := {1, 2, . . . , 6} × {1, 2, . . . , 6}. We define eleven subsets P2, P3, . . . , P12 of Throws as follows: Pk := {<m, n>: m + n = k} for k ∈ {2,...

Question