List some preventive and control measures for students regarding alcohol and drugs abuse.
In: Biology
List some preventive and control measures for students regarding alcohol and drugs abuse.
In: Biology
List the harmful effects caused by alcohol/drug abuse. Ans. Harmful effects caused by alcohol/drug abuse. Drug abusers who take it intravenously may cause
In: Biology
Which type of organ is spleen? What is its role and function in the body?
In: Biology
Given the DNA sequence matrix below:
Fern AGCCCAGGCTTCGAATGTCC
Pine AGCTTCAGTGTCGCACTTCC
Oak AGCTTCAGCGTCACACATCC
Moss AACCTTGGTGTCAAACGTCC
1. Assuming that Moss is the outgroup, draw all three possible
trees of evolutionary
relationships among these species. Label your trees A, B, and
C.
2. Sum up the number of differences between the DNA sequences for
all pairs of species
(There are 6 total pairs of species to be compared). Based on these
values, which tree (A,
B, or C) do you think is best under the Genetic Distance
criterion?
3. Determine the minimum number of mutations required under the
parsimony criterion for
each of the three trees. Which is the most parsimonious tree?
In: Biology
What is vaccination? What is the role of vaccines in body? Give two examples when immediate response is needed by body to defend it, name this type of immunization.
In: Biology
Which type of organ is spleen? What is its role and function in the body?
In: Biology
How is a cancerous cell different from a normal cell?
In: Biology
Answer each with a few sentences please:
1. Epiphyseal plate function and increase in length of a long bone
2. Osteoclast functions in bone ECM degradation
3. Cells in the osteogenic periosteum and what they do
4. Comparison of osteogenic and chondrogenic stem cells
In: Biology
What is vaccination? What is the role of vaccines in body? Give two examples when immediate response is needed by body to defend it, name this type of immunization.
In: Biology
(answer with a paragraph or a few sentences for each)
1. The structure of cartilage (in general), how types of cartilage differ from one another, and the importance of the perichondrium associated with cartilage
2. The activity of osteoblasts, balancing osteoclast activity with osteoblast activity, and ways through which various signal molecules control osteoclast activity
3. Comparison of cartilage and bone (particularly a long bone) with respect to the blood supply that supports cells of the tissue
In: Biology
Which of the following is correct order of the evolutionary history of man?
(a) Peking man homo sapiens, Neanderthal man, Cromagnon man
(b) Peking man, Heidelberg man. Neanderthal man, Cromagnon man
(c) Peking man, Heidelberg man. Neanderthal man, Cromagnon man
(d) Peking man, Neanderthal man. Homo sapiens, Heidelberg man.
In: Biology
Compare and contrast the following macromolecules in terms of their structure, function, synthesis and significance to the cell:
1. proteins
2. carbohydrates
3. lipids
4. aromatic bases
Which of the above could the cell survive longest without? Why?
In: Biology
Were Lamarck's ideas scientific?
How so? How might you test his hypothesis for evolution?
In: Biology
Theory of inheritance of acquired characters was given by
(a) Wallace
(b) Lamarck
(c) Darwin
(d) De Vries.
In: Biology