Question

Design a strategy to clone the full length of the DNA fragment shown below in the BamHI site of pBRT322 A plasmid vector. Note: The internal restriction sites of the fragment have been underlined. Describe the strategy in detail, and show the sequences of any primer(s) (if needed) you propose to use.

5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'

Answer 1

The DNA sequence given as insert has BamHI site. So you cannot clone the sequence using BamHI. However, I am providing how to clone the DNA in the pTBR322 vector and you can change to any other restriction enzyme using the same strategy.

Given:

Vector: pTBR322

Size: 4361bp

Selection marker: ampicillin, and tetracycline ( As tetracycline sequence has incorporated the BamHI site we will used ampicillin only. And if you used other restriction enzyme like PstI you will be using tetracyclin as selection marker.

Sequence to be cloned:5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'

Primer sequence:

Forward primer: CATGGGATCCTACTGATTCCAAAACTAAAA

Reverse Primer: GTAGCCTAGGTGGAGAGATTCGGTTTCTGC

The purple color sequence is the restriction site.

When you use another restriction enzyme for cloning, you can change the sequence in the purple and the sequence corresponding with that particular restriction enzyme.

Procedure for cloning of the provided sequence:

1. Amplify the DNA fragment with the above primers using Taq polymerase.

2. Digest the amplified DNA fragment using BamHI restriction enzyme.

3. Run the Digested fragment in Agarose gel and cut the DNA band from 75bp followed by gel extraction of the DNA.

4. Prepare the vector for ligation by, digestion with BamHI followed by alkaline phosphatase treatment. Alkaline phosphatase will remove the free -OH from 3' end of the DNA and protect the vector from self-ligation. Further, the digested vector should be gel extraction from agarose gel.

5. Ligate the vector and insert with the molar ratio of 1:3 ( vector to insert) using T4 DNA ligase.

6. Transform the ligated DNA in competent (42 degree celsius for 90 seconds) cell followed by plating in LB agar plate with ampicillin.

7. Select the single clones and screen using restriction digestion.

8. Sequencing of the positive clones