For each fragment of DNA provided: circle the promoter region transcribe the DNA into mRNA indicate...

For each fragment of DNA provided:

circle the promoter region
transcribe the DNA into mRNA
indicate the directionality on both the DNA fragment and mRNA
underline the mRNA start codon (if applicable)
circle the mRNA stop codon (if applicable)
build the polypeptide (if applicable) use the short form of the amino acids.
illustrate and label the bond type that holds the polypeptide together
provide an ordered list of the tRNA anticodons that were required to build the polypeptide

#1: GCCCTCGGCAAATTAATAGATCTGTACAACGCCTCGCAAATAACTGCG

#2:GCCCGATGCATTAATTAACCGTACCTTGATGCTAGGTGTATCTTA

Please help!

Expert Solution

gladiator answered 2 years ago

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced....

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5'-TAGTTAAAAC-3' Fragment 2: 5' - ACCGCAATACCCTAGTTAAA-3' Fragment 3: 5' - CCCTAGTTAAAAC-3' Fragment 4: 5' - ACCGCAATACCCTAGTT - 3' Fragment 5: 5' - ACCGCAATACCCTAGTTAAA - 3' Fragment 6: 5' - ATTTACCGCAAT - 3' On the basis of overlap in sequence, create a contig sequence of the original piece of DNA

-Describe the process of gel electrophoresis. How would the distance that each DNA fragment travelled on...

-Describe the process of gel electrophoresis. How would the distance that each DNA fragment travelled on your gel change if you were to make the gel using a higher percentage of agarose (for example 3%)? Explain -Describe the steps involved in a polymerase chain reaction (PCR), including the changes in temperature that are performed by the thermocycler and the purpose of each temperature change.

For the charge distribution provided, indicate the region (a to e) along the horizontal axis where a point exists at which the net electric field is zero.

Part A For the charge distribution provided, indicate the region (A to E) along the horizontal axis where a point exists at which the net electric field is zero. (Figure 1) If no such region exists on the horizontal axis choose the last option (nowhere). a.) A b.) B c.) C d.) D e.) E f.) nowhere Part B For the charge distribution provided, indicate the region (A to E) along the horizontal axis...

Question

For each fragment of DNA provided: circle the promoter region transcribe the DNA into mRNA indicate...

Solutions

Expert Solution

Related Solutions

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced....

-Describe the process of gel electrophoresis. How would the distance that each DNA fragment travelled on...

For the charge distribution provided, indicate the region (a to e) along the horizontal axis where a point exists at which the net electric field is zero.