Question

Design a strategy to clone the full length of the DNA fragment shown below in the BamHI site of pBRT322 A plasmid vector. Note: The internal restriction sites of the fragment have been underlined. Describe the strategy in detail, and show the sequences of any primer(s) (if needed) you propose to use.

5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'

Answer 1

The Provided DNA sequence cannot be clone in BamHI site as the insert has an internal BamHI restriction site, ie., GGATCC

But the cloning procedure will follow as follow:

pBRT322 is a vector of 4361bp and below is the map for the vector with restriction sites.

Insert sequence: 5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'

Restriction site to be used : BamHI : sequence: GGATCC

primers to be used:

forward primers: GATCGGATCCTACTGATTCCAAAACTAAAA

reverse primer: CTAGCCTAGGTGGAGAGATTCGGTTTCTGC

Blue is the restriction enzyme binding sites

Yellow is the restriction sequence

If you want to clone the sequence using different restriction site use the sequence recognition of that restriction enzyme in place of yellow-colored sequences.

Green is the insert sequence.

Step1. PCR amplify the insert using the primers mentioned above.

Step2. Digest the PCR amplified sequence with BamHI.

Step 3: Gel extract the DNA band obtained at 70bp.

Step4 . Digest the vector with BamHI followed by alkaline phosphatase enzyme treatment for 15 mins. Alkaline phosphatase will remove the free -OH from 3' end and avoiding self-ligation of the vector.

Step5. Gel extraction of the vector (Size 4361bp).

Step 6: Ligation of vector and insert using T4 DNA ligase.

Step 7: Transformation of ligated DNA using competent cell (like DH5alpha)

Step 8: Plating of transformed cells in LB-agar plate with Ampicillin antibiotic.

Step 9: Selection of single clones and plasmid DNA isolation

Step10 Digestion of plasmid DNA with BamHI. After restriction digestion with BamHI there should be two bands, one at 4361bp and another at 75bp.

Step11: sequencing of positive clone using sanger sequencing to further confirm the insert sequence.