Question

In: Biology

Short note for the below: Amplified Fragment Length Polymorphism (AFLP) Human-animal chimaeras NF-kB signaling pathway DNA...

Short note for the below:

Amplified Fragment Length Polymorphism (AFLP)
Human-animal chimaeras
NF-kB signaling pathway
DNA aptamers and their applications
Riboseitches
Structure and fuction of the aryl hydrocarbon receptor (AhR) (in Toxicology)
Epignetics of Rett Syndrom
Gene-knockout mice and applications

Solutions

Expert Solution

a. Amplified fragment length polymorphism (AFLP) is a DNA fingerprinting method that employs restriction enzyme digestion of DNA followed by selective amplification of a subset of fragments and separation by electrophoresis on a polyacrylamide gel.

b. If a human chimera is formed from a male and female zygote fusing into a single embryo, giving an individual functional gonadal tissue of both types, such self-fertilization is feasible. Indeed, it is known to occur in non-human species where hermaphroditic animals are common, including some mammals.

c.

NF-kB is a short name of the Nuclear Factor kappa-light-chain-enhancer of activated B cells. It is not a single protein, but a small family of inducible transcription factors that play an important role in almost all mammalian cells. It controls DNA transcription, cytokine production, cell survival, and other important cell events, especially plays a key role in regulating the immune response to infection.

NF-kB molecular are usually dimers. A typical structure of NF-kB is a P50-P65 dimer (NF-kB1/RelA). The dimer formation is necessary for DNA binding, two NF-κB monomers bind to DNA as a dimer. The N-terminal regions of the dimer are responsible for specific DNA contact. The C-terminal regions are usually highly conserved, they are responsible for dimerization and nonspecific DNA phosphate contact. The whole NF-kB molecular is just like a pliers vise on the DNA chain and functions as a transcription factor.

d.Aptamers are short, single-stranded DNA, RNA, or synthetic XNA molecules that can be developed with high affinity and specificity to interact with any desired targets. They have been widely used in facilitating discoveries in basic research, ensuring food safety, and monitoring the environment

e.In molecular biology, a riboswitch is a regulatory segment of a messenger RNA molecule that binds a small molecule, resulting in a change in the production of the proteins encoded by the mRNA.Thus, an mRNA that contains a riboswitch is directly involved in regulating its own activity, in response to the concentrations of its effector molecule. The discovery that modern organisms use RNA to bind small molecules, and discriminate against closely related analogs, expanded the known natural capabilities of RNA beyond its ability to code for proteins, catalyze reactions, or to bind other RNA or protein macromolecules.

f. The aryl hydrocarbon receptor (AhR) is a ligand-dependent transcription factor that mediates many of the biological and toxicological actions of a variety of hydrophobic natural-synthetic chemicals, including the environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD).

g. Epigenetics play key roles in development and cell fate commitments and highly impact the etiology of many human diseases. A well-known link between epigenetics and human disease is the X-linked MECP2 gene, mutations in which lead to the neurological disorder, Rett Syndrome.

h.Gene knockout method is used for constructing genetically modified organism such as GM plants, GM bacteria and GM animals. It is also used to study the effect and contribution of a particular gene and its role in the development of a disease.


Related Solutions

Design a strategy to clone the full length of the DNA fragment shown below in the...
Design a strategy to clone the full length of the DNA fragment shown below in the BamHI site of pBRT322 A plasmid vector. Note: The internal restriction sites of the fragment have been underlined. Describe the strategy in detail, and show the sequences of any primer(s) (if needed) you propose to use. 5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'
Design a strategy to clone the full length of the DNA fragment shown below in the...
Design a strategy to clone the full length of the DNA fragment shown below in the BamHI site of pBRT322 A plasmid vector. Note: The internal restriction sites of the fragment have been underlined. Describe the strategy in detail, and show the sequences of any primer(s) (if needed) you propose to use. 5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT