A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,...

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2).

5’ AGATCGGATCGTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 3’

Identify the DNA sequence that encodes each peptide
Determine the amino acid sequence of each peptide
In a mutant viral strain, the T at position 23 has been replaced with a G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.

Solutions

Expert Solution

gladiator answered 1 year ago

Next > < Previous

Related Solutions

7.Review the structure of DNA. What is meant by a double-stranded structure with complementary anti-parallel strands?...

7.Review the structure of DNA. What is meant by a double-stranded structure with complementary anti-parallel strands? 8. What is the difference between replicating the leading strand and the lagging strand? 9. What is the role of each of the following in DNA replication: origin of replication, helicase, single-strand binding proteins, primase, DNA polymerase III, DNA polymerase I, ligase, and topoisomerase, Okazaki fragments, and telomerase? 10. What problem does the mechanism of DNA replication pose for the ends of linear eukaryotic...

. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that...

. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TAC ATG ATC ATT TCA CGG AAT TTC TAG CAT GTA ATG TAC TAG TAA AGT GCC TTA AAG ATC GTA CAT a. Which strand of DNA is transcribed and in which direction? Support your response by indicating the 5 amino acid sequence that results when this transcript is translated. (2 pts) b. Label the 5’ and the 3’...

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA...

Given this segment of a double-stranded DNA molecule, draw the two major steps involved in DNA replication: ATCGGCTAGCTACGGCTATTTACGGCATAT TAGCCGATCGATGCCGATAAATGCCGTATA

Design a strategy to clone the full length of the DNA fragment shown below in the...

Design a strategy to clone the full length of the DNA fragment shown below in the BamHI site of pBRT322 A plasmid vector. Note: The internal restriction sites of the fragment have been underlined. Describe the strategy in detail, and show the sequences of any primer(s) (if needed) you propose to use. 5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'

Design a strategy to clone the full length of the DNA fragment shown below in the...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and...

( This is the 3 topic for question 1) DNA is a double-stranded helix, DNA and RNA are polymers of nucleotides, DNA replication depends on specific base pairing 1) Post three topics or quotes that you found interesting from chapter 10, and explain why. Also respond to at least three other classmates using the 3C+Q method. 2) Name three changes that you could make to decrease your ecological footprint. 3) What can we do to preserve and restore biodiversity? 4)...

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded...

1. If you started a PCR protocol with 10 double-stranded molecules of DNA, how many double-stranded molecules of the product would you have after 5 cycles of PCR? 2. What is the purpose of using DNA polymerase from Thermus aquaticus for the polymerase chain reaction rather than a DNA polymerase from a better characterized bacterium such as E. coli?

DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield...

DNA footprinting is based on the idea that certain DNA endonucleases degrade double‑stranded DNA to yield mononucleotides and dinucleotides, but these enzymes do not degrade those sequences to which other proteins are bound such as RNA polymerase. Why is this method done in the absence of ribonucleotide triphosphates?

The following sequence of 30 nucleotides corresponds to one of the two strands of a double...

The following sequence of 30 nucleotides corresponds to one of the two strands of a double stranded DNA: 5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’ a) This sequence has two perfect palindromes that consist of 6 base pairs each. What is the sequence of these two palindromes? b) Show both strands of your FIRST palindrome (indicate the 5’-3’ polarity) c) Show both strands of your SECOND palindrome (indicate the 5’-3’ polarity) Assume that the two palindromes are recognized by “6-cutter” restriction enzymes, and that...

Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme.

Propose a chemical mechanism for the cleavage of double stranded DNA by a restriction enzyme. At a minimum, how many specific domain types must there be and what role does each play. Explain the role of any cofactors necessary in the reaction.

Subjects