Question

In: Biology

One can take a fragment of genomic DNA carrying a eukaryotic gene and clone it into...

One can take a fragment of genomic DNA carrying a eukaryotic gene and clone it into a bacterial plasmid, containing an origin of replication and a selectable marker gene. Although the eukaryotic DNA can be stably replicated in the bacteria, the gene is often not expressed. Explain four possible reasons why this is the case.

Solutions

Expert Solution

1) May be gene is not correctly oriented in the plasmid due to ligation in reverse direction. So the gene being read in reverse which is a totaly different sequence.

2) Bacteria lacks nucleus where transcription happens in eukaryotic cells. There the eukaryotic mRNA will undergo post transcriptional modifications too, inorder to protect the mRNA from cellular nucleases. So in the absence of all these requirements the expressed mRNA may be prone to degradation in bacteria.

3) Eukaryotic genes contain noncoding regions called introns which are removed by splicing in eukaryotic cells. Introns are absent in prokaryotic genes and there is no splicing mechanism in bacteria. So presence of non coding region may be hindering the translation process of the mRNA to protein.

4) The eukaryotic proteins undergo post translational modifications like glycosylation, phosphorylation etc. This mechanism is absent in bacteria. So in the absence of this modification the protein may be unstable in bacteria and is being degraded.


Related Solutions

Design a strategy to clone the full length of the DNA fragment shown below in the...
Design a strategy to clone the full length of the DNA fragment shown below in the BamHI site of pBRT322 A plasmid vector. Note: The internal restriction sites of the fragment have been underlined. Describe the strategy in detail, and show the sequences of any primer(s) (if needed) you propose to use. 5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'
Design a strategy to clone the full length of the DNA fragment shown below in the...
Design a strategy to clone the full length of the DNA fragment shown below in the BamHI site of pBRT322 A plasmid vector. Note: The internal restriction sites of the fragment have been underlined. Describe the strategy in detail, and show the sequences of any primer(s) (if needed) you propose to use. 5’TACTGATTCCAAAACTAAAGGATCCAAAAAAAAACTGCAGAAACCGAATCTCTCCA3'
In order to clone a DNA gene, it is inserted into a larger vector. Why should...
In order to clone a DNA gene, it is inserted into a larger vector. Why should the vector used be larger?
In a linear fragment of DNA, the ends can not be replicated by DNA polymerases.
  What are the SD sequences? Found in the promoters of RNA polymerase I Found in the promoters of RNA polymerase II Found in the promoters of RNA polymerase III Ribosome binding sites in prokaryotic mRNA Ribosome binding sites in eukaryotic mRNA In a linear fragment of DNA, the ends can not be replicated by DNA polymerases.      Eukaryotes use telomerase enzyme to replicate chromosome tips. This enzyme has DNA polymerase activity RNA polymerase activity Reverse transcriptase activity DNA ligase...
How would you clone the Eukaryotic gene into the plasmid How would you transform bacteria with...
How would you clone the Eukaryotic gene into the plasmid How would you transform bacteria with that engineered plasmid How would you select for the bacteria that will take up the plasmid with integrated Eukaryotic gene
Describe one method of eukaryotic gene regulation that can happen in each of the following cases:...
Describe one method of eukaryotic gene regulation that can happen in each of the following cases: Transcription After transcription is completed, before the transcript leaves the nucleus After the transcript leaves the nucleus Translation
Name and describe one method a eukaryotic cell can regulate transcription of a gene Name and...
Name and describe one method a eukaryotic cell can regulate transcription of a gene Name and describe one method a eukaryotic cell can regulate translation of a gene Name and describe one method a eukaryotic cell can regulate expression of a gene at any level
3) How can you use PCR to clone a 2000bp gene into a plasmid vector?
3) How can you use PCR to clone a 2000bp gene into a plasmid vector?
Describe the role of DNA methylation in eukaryotic gene expression.In your answer explain how patterns of...
Describe the role of DNA methylation in eukaryotic gene expression.In your answer explain how patterns of methylation are maintained after DNA replication. (include diagram)
​​​​​​​Describe how you can use PCR to obtain a gene fragment X that can be cloned...
​​​​​​​Describe how you can use PCR to obtain a gene fragment X that can be cloned into a plasmid vector for expression of the recombinant protein. Include in your description how the PCR reaction will be performed, how the amplicon will be analyzed, the use of restriction enzymes, how cloning will be achieved, how you will know that you have a recombinant containing the insert gene fragment X and how you will detect the recombinant protein.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT