In a linear fragment of DNA, the ends can not be replicated by DNA polymerases.

What are the SD sequences?

Found in the promoters of RNA polymerase I
Found in the promoters of RNA polymerase II
Found in the promoters of RNA polymerase III
Ribosome binding sites in prokaryotic mRNA
Ribosome binding sites in eukaryotic mRNA

In a linear fragment of DNA, the ends can not be replicated by DNA polymerases. Eukaryotes use telomerase enzyme to replicate chromosome tips. This enzyme has

DNA polymerase activity
RNA polymerase activity
Reverse transcriptase activity
DNA ligase activity
DNA helicase activity

Expert Solution

A. SD sequences - d. Ribosome binding sites in prokaryotic mRNA

explanation - Shine darlago sequeence is a sequence which helps in the attachment mrna of the prokaryotic mrna with the ribosomes small subunit.

A. In a linear fragment of DNA, the ends can not be replicated by DNA polymerases. Eukaryotes use telomerase enzyme to replicate chromosome tips. This enzyme has - RNA polymerase activity

explanation - Eukaryotic dna ploymerase cannot replicate the end of dna so telomerase enzymes which is a rna polymerase thay used to extend certain base pair which helps in the replication of the end region.

gladiator answered 2 years ago

DNA is replicated by the semi-conservative model. Describe this process in eukaryotes (linear chromosomes). Include what...

DNA is replicated by the semi-conservative model. Describe this process in eukaryotes (linear chromosomes). Include what enzymes are involved and what is their role in the process? What happens at the ends of linear chromosomes?

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced....

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5'-TAGTTAAAAC-3' Fragment 2: 5' - ACCGCAATACCCTAGTTAAA-3' Fragment 3: 5' - CCCTAGTTAAAAC-3' Fragment 4: 5' - ACCGCAATACCCTAGTT - 3' Fragment 5: 5' - ACCGCAATACCCTAGTTAAA - 3' Fragment 6: 5' - ATTTACCGCAAT - 3' On the basis of overlap in sequence, create a contig sequence of the original piece of DNA

There are several types of DNA polymerases and RNA polymerases – yet there is only one...

There are several types of DNA polymerases and RNA polymerases – yet there is only one ribosome. Why is that?

9. The process of DNA replication creates a particular problem for replicating the ends of linear...

9. The process of DNA replication creates a particular problem for replicating the ends of linear chromosomes. a) Describe why the DNA replication machinery has difficulty replicating DNA ends. b) Telomerase has been identified as an enzyme that can reverse the outcome of end replication. Describe the near-universal mammalian chromosome telomere sequence and how telomerase solves the problem of end replication.

Describe how methylation occurs on newly replicated DNA

Experiment 2- Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector “Table 1: Fragment Lengths” “DNA...

Experiment 2- Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector “Table 1: Fragment Lengths” “DNA Type” “Longest Length (in base pairs)” “Foreign” 720 “Plasmid” 2804 1. What is the expected size of the plasmid plus the cut foreign DNA? 2. What type of ends to the enzymes BamHI and EcoRI produce? How does this type of end facilitate cloning? 3. What enzyme is necessary to permanently link the digested foreign and plasmid DNA together to form the recombinant DNA...

Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector” “Table 1: Fragment Lengths” DNA TYPE: LONGEST...

Cloning a DNA Fragment to a Bacterially-Derived Plasmid Vector” “Table 1: Fragment Lengths” DNA TYPE: LONGEST LENGTH FOREIGN: 716 PLASMID: 2837 Post-Lab Questions 1. What is the expected size of the plasmid plus the cut foreign DNA? 2. What type of ends to the enzymes BamHI and EcoRI produce? How does this type of end facilitate cloning? 3. What enzyme is necessary to permanently link the digested foreign and plasmid DNA together to form the recombinant DNA molecule? How does...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following...

PCR can be utilized to generate a large quantity of a specific DNA fragment. The following questions refer to a PCR reaction designed to amplify the DNA helix below. Region 1 Region 2 5’ GCTAGCTGTGGCTTAATATAGCCCGCAGTAGCGT 3’ b. While mixing up the PCR reaction mix, you accidentally add too little of the concentrated buffer, thus producing a lower than anticipated ion concentration. To compensate, you should (INCREASE/DECREASE/NOT ALTER) the denaturation temperature. Which of the explanations below best supports your answer? A....

One can take a fragment of genomic DNA carrying a eukaryotic gene and clone it into...

One can take a fragment of genomic DNA carrying a eukaryotic gene and clone it into a bacterial plasmid, containing an origin of replication and a selectable marker gene. Although the eukaryotic DNA can be stably replicated in the bacteria, the gene is often not expressed. Explain four possible reasons why this is the case.

If a segment of DNA were replicated without any errors, the replicated strand would have the following sequence of nucleotides:

Base substitution mutations and frameshift mutations If a segment of DNA were replicated without any errors, the replicated strand would have the following sequence of nucleotides:5' - ACTACGTGA - 3'Sort the following replicated DNA sequences by the type of point mutation each contains (frameshift, base substitution, or neither), as compared to the correct sequence shown above. Sort the items into the appropriate name as frameshift mutation, base substitution mutation and or neither5'-ACTCGTGA-3'5'-ATTACGTGA-3'5'-ACTACGTGT-3'5'-ACTAAGTGA-3'

Question