Question

In: Biology

You have created a cell-free (in vitro) transcription system that contains a bacterial gene. It is...

You have created a cell-free (in vitro) transcription system that contains a bacterial gene. It is able to initiate transcription but does so at random locations on the DNA.

Which of the following proteins is most likely missing from the reaction?

A.

Sigma factor

B.

Rho factor

C.

RNA polymerase

D.

5' cap proteins

E.

DNA polymerase

Solutions

Expert Solution

The protein which is most likely missing, in this case, is the SIGMA FACTOR.

Sigam factor is a type of protein which is when associated with RNA polymerase, the whole complex is known as RNA polymerase holoenzyme. This sigma factor is responsible for the recognition and binding of the RNA polymerase to a specific promoter sequence. After binding, the sigma factor detaches and the RNA polymerase core enzyme begins transcription. Therefore, without the sigma factor, RNA polymerase can't bind to specific sites and will start binding to random locations.

Rho factor is a type of protein involved in the transcription process but it aids in the termination of transcription in prokaryotes. It has no part in the start of transcription or elongation.

RNA polymerase is the enzyme which conducts the transcription process. As the gene is being transcribed, we can say that RNA polymerase is not missing.

5' cap proteins are found in eukaryotic RNA which attaches to it during RNA modification. It protects the eukaryotic RNA from degradation. As the gene mentioned here is from a prokaryotic cell, Cap proteins are not needed here. Further, they are not involved in transcription.

DNA polymerase is the enzyme required for the replication of DNA. Therefore, it has no part here.

HENCE, THE PROTEIN WHICH IS MOST LIKELY MISSING IS SIGMA FACTOR.


Related Solutions

Bacterial cells regulate gene expression at both transcription and translation levels. Transcription is controlled by transcription...
Bacterial cells regulate gene expression at both transcription and translation levels. Transcription is controlled by transcription factors or DNA binding proteins that bind promoters (regulatory sequences of genes) and prevent or promote RNA Polymerase binding. Positive control of transcription involves both disabling a repressor and allowing an activator to bind the promoter. Similarly, negative control results in detachment of the activator and binding of the repressor to turn off transcription. Inducible genes encode enzymes involved in catabolic pathways. These genes...
Describe the differences in transcription between a bacterial and a eukaryotic cell.
Describe the differences in transcription between a bacterial and a eukaryotic cell.
Bacterial transformation allows a gene from another organism to be put into a bacterial cell. This...
Bacterial transformation allows a gene from another organism to be put into a bacterial cell. This would allow the bacterial cell to produce the protein that the gene codes for. Several steps are needed to transform bacteria; put the following steps in the correct order. 1. Add a bacterial promoter and terminator, and add sequences that will be cut by a specific restriction enzyme to the ends of the DNA piece. 2.Cut the cDNA and plasmid with the same restriction...
Que . When phage infect a bacterial cell, they typically have a temporal program of gene...
Que . When phage infect a bacterial cell, they typically have a temporal program of gene expression, i.e., they express particular genes at particular times. What are two regulatory mechanisms phage use to control their gene expression? Please state clearly each mechanism and provide detail explanation.
1.You have discovered a novel toxin-encoding gene in a bacterial pathogen. An adjacent gene encodes a...
1.You have discovered a novel toxin-encoding gene in a bacterial pathogen. An adjacent gene encodes a putative transcriptional regulator protein. You decide to identify the promoter for the toxin gene and investigate whether the transcriptional regulator protein controls expression from this promoter. Describe your experimental approach to investigate these questions 2a.Describe how the lac repressor protein is involved in controlling expression of the lac operon. 2b.Explain the difference between homologous recombination and site-specific recombination. 3a.Most genome sequencing projects have used...
Due to system limitations you are attempting to clone a small bacterial gene using a poorly...
Due to system limitations you are attempting to clone a small bacterial gene using a poorly characterised bacterial plasmid. You know that the plasmid contains only two drug resistance markers (one for resistance to tetracycline, another for resistance to ampicillin). You have determined that the restriction enzymes EcoRI and BamHI each cut the plasmid only once while SauIII and RsaI cut the plasmid twice. You also have determined that the EcoRI and SauIII recognition sites are within the tetracycline resistance...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...
In vitro transcription: .If you wanted to ensure that you only synthesized “insert RNA”, what steps...
In vitro transcription: .If you wanted to ensure that you only synthesized “insert RNA”, what steps would have to be taken?
In in vitro transcription: Is the RNA produced sense or antisense? How can you tell? How...
In in vitro transcription: Is the RNA produced sense or antisense? How can you tell? How could you produce the opposite strand
Name and describe one method a eukaryotic cell can regulate transcription of a gene Name and...
Name and describe one method a eukaryotic cell can regulate transcription of a gene Name and describe one method a eukaryotic cell can regulate translation of a gene Name and describe one method a eukaryotic cell can regulate expression of a gene at any level
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT