Question

In: Biology

Name and describe one method a eukaryotic cell can regulate transcription of a gene Name and...

Name and describe one method a eukaryotic cell can regulate transcription of a gene

Name and describe one method a eukaryotic cell can regulate translation of a gene

Name and describe one method a eukaryotic cell can regulate expression of a gene at any level

Solutions

Expert Solution

REGULATION OF OF TRANCRIPTRANS IN EUKARYOTES

METHYLATION OF DNA is a mechanism of regulation of transcription in eukaryotes that vertebrates is linked to chromatin structure. Cytosine residues in vertebrate DNA can be modified by the addition of methyl groups at the 5-carbon position .DNA is methylated specifically at the C's that precede G's in the DNA chain. This methylation is correlated with reduced transcriptional activity of genes that contain high frequencies of CpG dinucleotides in the vicinity of their promoters. Methylation inhibits transcription of these genes via the action of a protein, MeCP2, that specifically binds to methylated DNA and represses transcription. Interestingly, MeCP2 functions as a complex with histone deacetylase, linking DNA methylation to alterations in histone acetylation and nucleosome structure

DNA METHYLATION

Then in the case of prokaryotes,TRANSLATIONAL CONTROL VIA CAP RECOGNITION PROCESS

A mechanism in eukaryotes to control the rate of translation initiation involves the mRNA 5′-cap recognition process by eIF4F. Binding of eIF4F to the cap structure can be hindered by the eIF4E homolog, 4E-HP .The interaction between eIF4G and eIF4E in the eIF4F complex is inhibited by members of a family of related proteins, termed eIF4E-binding proteins.The 4E-BPs compete with eIF4G for a shared binding site on eIF4E. Consequently, 4E-BPs inhibit cap-dependent, but not IRES-dependent, translation. 4E-BP binding to eIF4E is controlled by phosphorylation. Hypo-phosphorylated 4E-BPs bind strongly to eIF4E, whereas phosphorylation of 4E-BPs weakens their interaction with eIF4E .

Eukaryotic gene expression involves many steps, and almost all of them can be regulated. Different genes are regulated at different points, and it’s not uncommon for a gene to be regulated at multiple steps.

One of the step is chromatin accessibility.

  • Chromatin accessibility. The structure of chromatin DNA and its organizing proteins) can be regulated. More open or “relaxed” chromatin makes a gene more available for transcription.


Related Solutions

Describe one method of eukaryotic gene regulation that can happen in each of the following cases:...
Describe one method of eukaryotic gene regulation that can happen in each of the following cases: Transcription After transcription is completed, before the transcript leaves the nucleus After the transcript leaves the nucleus Translation
Describe the differences in transcription between a bacterial and a eukaryotic cell.
Describe the differences in transcription between a bacterial and a eukaryotic cell.
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...
Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...
Describe how members of the CREB, CREB-like and AP1 families of transcription factors regulate gene transcription...
Describe how members of the CREB, CREB-like and AP1 families of transcription factors regulate gene transcription Outline in detail how activation of PKA, MAPKs and CaMKII can lead to gene transcription through CREB
Bacterial cells regulate gene expression at both transcription and translation levels. Transcription is controlled by transcription...
Bacterial cells regulate gene expression at both transcription and translation levels. Transcription is controlled by transcription factors or DNA binding proteins that bind promoters (regulatory sequences of genes) and prevent or promote RNA Polymerase binding. Positive control of transcription involves both disabling a repressor and allowing an activator to bind the promoter. Similarly, negative control results in detachment of the activator and binding of the repressor to turn off transcription. Inducible genes encode enzymes involved in catabolic pathways. These genes...
Describe, in detail, 3 ways that a eukaryotic cell regulates gene expression.
Describe, in detail, 3 ways that a eukaryotic cell regulates gene expression.
The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin?
The promoter is an important sequence for transcription of a gene. Which of these components binds to the promoter of a eukaryotic gene to allow transcription to begin? Select all that are correct.A. Ribosomal subunitsB. A start codonC. DNA polymerase enzymeD. General transcription factorsE. RNA polymerase enzyme
A) cAMP and CREB- how phosphorylation can regulate gene transcription? B) Purpose of second messengers and...
A) cAMP and CREB- how phosphorylation can regulate gene transcription? B) Purpose of second messengers and what molecules are used as second messengers? C) Describe G proteins structure, how are they activated, how they transduce the signal D) Describe Tryosine Kinase Receptors structure, how they are activated, how they transduce the signal.
Eukaryotic Transcription Factors (TF) can be described as:
Eukaryotic Transcription Factors (TF) can be described as:a. Activators that recruit co-activators to initiate transcription of the geneb. cis-acting transcriptional elementsc. proteins that interact with the promoter/enhancer regions via DNA binding domainsd. multimeric components of nucleosomes
1. Eukaryotic transcription factors control gene expression in a combinatorial manner. a) With the aid of...
1. Eukaryotic transcription factors control gene expression in a combinatorial manner. a) With the aid of a diagram, briefly discuss this statement. b) Provide an example of how combinatorial regulation of gene expression is involved in the development of higher organisms.
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT