Question

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right.

5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’

1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+ - 50

3’-GGCTATTTACCGGCTAATGCTATACGGTCTAGTAATGTTGATTGCTCCGG -5’

Transcribe and translate this sequence

Answer 1

Transcription- In this process information in a DNA strand is copied into a new molecule of messenger RNA (mRNA). It is performed by an enzyme called RNA polymerase which uses a single-stranded DNA template to synthesize a complementary strand of RNA. RNA polymerase transcribes the DNA template in 5' to 3' direction, therefore, 3' to 5' strand of DNA will act as a template and the other strand will act as a coding strand.

3’-GGCTATTTACCGGCTAATGCTATACGGTCTAGTAATGTTGATTGCTCCGG -5’ - Template strand

Transcription takes place in this template strand and the transcribed product will be:-

5'-ACCGUAAAUGGCCGAUUACGAUAUGCCAGAUCAUUACAACUAACGAGGCC -3'

In RNA, instead of thiamine, uracil is present.

Translation- It is a process by which the genetic code contained within an mRNA strand is decoded in order to produce the specific sequence of amino acids. This mRNA strand is being read in a group of three bases known as codons.

The start codon of an mRNA transcript translated by a ribosome and in eukaryotes, it codes for methionine. The most common start codon is AUG. Termination of translation is initiated when a stop codon (UAG, UAA, or UGA) enters the ribosome, and thus separate the polypeptide chain from its tRNA.

So translation will start from AUG and it will at either UAA, UAG, or UGA.

5'-ACCGUAAAUGGCCGAUUACGAUAUGCCAGAUCAUUACAACUAACGAGGCC -3' -mRNA strand

After the first seven bases, there is an AUG codon and before the last seven bases, there is a stop codon UAA.

Translation:-

Met~Ala~Asp~Tyr~Asp~Meth~Pro~Asp~His~Tyr~Asn (Polypeptide chain)

start codon(AUG) stop codon (UAA)