Describe the differences in transcription between a bacterial and a eukaryotic cell.

Expert Solution

Differences in transcription between a bacterial and a eukaryotic cell:

1.In prokaryotes transcription occurs in the cytoplasm of the cell.

In eukaryotes transcription occurs in the nucleus.

2. In prokaryotes Transcription and translation occurs simultaneously.

In eukaryotes first RNA is transcribed then translated.

3.Prokaryotes transcription uses only one type of RNA polymerase.

Eukaryotes transcription uses three types of RNA polymerases.

4. In prokaryotes introns absent in the mRNA.

In eukaryotes introns present in the primary transcript.

5. In prokaryotes RNA capping is absent.

In eukaryotes RNA capping is present.

gladiator answered 2 years ago

A. Describe three important differences in the transcription of mRNA's between bacterial and eukaryotic cells. B....

A. Describe three important differences in the transcription of mRNA's between bacterial and eukaryotic cells. B. In the synthesis of cDNA libraries for eukaryotic genes, reverse transcriptase can be used with a primer containing poly(T). Why is this NOT useful for prokaryotic systems?

what are the similarties and differences between bacterial, archael, and eukaryotic transcription ( using RNa pol...

what are the similarties and differences between bacterial, archael, and eukaryotic transcription ( using RNa pol II) initiation.

Bacterial cells couple the process of transcription and translation. In eukaryotic cells, the process of transcription...

Bacterial cells couple the process of transcription and translation. In eukaryotic cells, the process of transcription and translation are uncoupled or occur separately. Provide explanations as to why bacterial cells can couple the process of transcription and translation while in eukaryotic cells, the process is separated.

Name and describe one method a eukaryotic cell can regulate transcription of a gene Name and...

Name and describe one method a eukaryotic cell can regulate transcription of a gene Name and describe one method a eukaryotic cell can regulate translation of a gene Name and describe one method a eukaryotic cell can regulate expression of a gene at any level

Need a precise rundown of differences between the cell envelope of a Gram-negative bacterial cell and...

Need a precise rundown of differences between the cell envelope of a Gram-negative bacterial cell and a Gram-positive bacterial cell, how the cell membranes and cell walls are different between them and important features.

Distinguish between the structure of a prokaryotic cell and that of a eukaryotic cell.

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the...

Part of a gene sequence from a eukaryotic cell is written below. Transcription begins at the boxed G/C base pair and proceeds from left to right. 5’-CCGATAAATGGCCGATTACGATATGCCAGATCATTACAACTAACGAGGCC -3’ 1 - - - - - - - - - - +- - - - - - - - - - -+- - - - - - - - - - +- - - - - - - - -+ - - - - - - - - - - - -+...

describe the process of Eukaryotic transcription in detail please. Thank you.

1-Give any two differences between archaea plasma membrane VS the bacterial and eukaryotic membrane. 2-What is...

1-Give any two differences between archaea plasma membrane VS the bacterial and eukaryotic membrane. 2-What is difference between the L wall of gram-positive and negative bacteria? 3-Name any 2 structures that are outside the prokaryotic cell wall? 4- what is the difference between amphitrichous and peritrichous flagellar arrangement? 5- what are the general function of a cell wall in a eukaryotic cell?

Describe the differences between the following: 1) general transcription factor vs. specific transcription factor 2) channel...

Describe the differences between the following: 1) general transcription factor vs. specific transcription factor 2) channel protein vs. carrier protein 3) saturated fatty acid vs. unsaturated fatty acid 4) free ribosome vs. bound ribosome 5) ligand-gated channel vs. voltage-gated channel 6) aquaporin transport vs. Na+/K+ pump transport

Question