Question

In: Biology

1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’...

1. The given mRNA sequence is transcribed from the gene below it.

5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’

3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’

5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’

Within the double-stranded DNA above:

a. Which strand ( top / bottom ) is the coding strand?

b. Circle the -10 promoter element.

c. Underline a single nucleotide indicating the transcription start site.

d. Circle the translation start and stop codons.

e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always some 5’ untranslated region encoded in the mRNA. Give the N and C ends of the protein.

Solutions

Expert Solution

Question 1 A

In the given DNA the top strand acts as the template strand because the transcription occurs from the 3' end of the DNA. The given mRNA is complementary to the top strand.

Question 1 B

3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’

5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’

The promoter region is a region in the DNA where the transcription machinery binds. In the given mRNA the promoter is present at the -10 region of the DNA. It contains a TATA box. TATA box is a promoter region found eukaryotes and Archaea. It is labeled in red color

Question 1 C

3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’

5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’

The transcription start site is a base in the DNA from which the transcription begins. In the given DNA it is marked in red.

Question 1 D

5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’

Translation begins from the start codon. AUG is the universal start codon. There are three stop codons like UGA, UAG, and UAA. In the given mRNA, the start codon marked in green color, and the stop codon marked in red color.

Question 1 E

The 5' untranslated region is the bases that are found prior to the start codon in the mRNA. The amino acid sequence of the given mRNA is follows

N terminus- Met- Gln- Gly- His- Pro- Ile- Thr- Met - C terminus

The transcription occurs from the 5' end of the mRNA and amino acids were added in N to C direction.

gladiator answered 1 day ago
Next > < Previous

Related Solutions

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’...
5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’ and 3’ ends. (2 pts.) c. Circle the start and stop codons in the sequence you wrote in b. (2 pts.) d. Write the protein sequence translated for this gene. (2 pts.) e. The anticodon of the tRNA which carries the last amino acid will be: ____________ (2 pts.) 2. Write one sentence using the words promoter, transcription factors and RNA polymerase to describe...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in these faecal samples...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.Describe the principles behind and the applications of the following: a) Northern blotting b) Site-directed mutagenesis c) DNase l footprinting d) Fusion protein vectors e) Sanger Sequencing of DNA 3.Describe six differences between DNA replication in bacteria compared with eukaryotes.
1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed. •Cis- and...
1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed. •Cis- and Trans-acting elements can u tell me plzz in brief
Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA,...
Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. Question 2. You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in...
A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...
A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed
An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and...
An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5’ and 3’ polarity. Change the font (where it says paragraph above) to "preformatted" to get a constant-width font the will make your sequence more readable. (3 pts) Use the genetic code to write the N to C sequence of the protein specified by this RNA. Remember that the...
Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...
Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.
Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’...
Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’ AUCCGACCGU 3’ 5’ TGCCAGCCTA 3’ 5’ UGCCAGCCUA 3’ Answer question a in the first row (with a number). For statements b-k, enter an X to indicate if it is associated with DNA replication, transcription or translation. A statement may apply to more than one. DNA Replication Transcription Translation Number of template DNA strands? ________ ________ N/A Uses DNA polymerase Uses RNA polymerase Requires ribosomes...
1) You sequence a gene of interest and isolate the matching mRNA. You find that the...
1) You sequence a gene of interest and isolate the matching mRNA. You find that the mRNA is considerably shorter than the DNA sequence. Why is that? a) There was an experimental mistake. The mRNA should have the same length as the gene. b) The mRNA should be longer than the DNA sequence because the promoter is also transcribed. c) The processed mRNA is shorter because introns were removed. d) The mRNA is shorter because the signal sequence to cross...
ADVERTISEMENT
Subjects
ADVERTISEMENT
Latest Questions
ADVERTISEMENT