Question

In: Biology

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’...

5'-tatctatggcatggcgatcatagaggcgtg-3'

3'-atagataccgtaccgctagtatctccgcac-5’

a. Write the mRNA sequence for this gene. Be sure to label the 5’ and 3’ ends. (2 pts.)

c. Circle the start and stop codons in the sequence you wrote in b. (2 pts.)

d. Write the protein sequence translated for this gene. (2 pts.)

e. The anticodon of the tRNA which carries the last amino acid will be: ____________ (2 pts.)

2. Write one sentence using the words promoter, transcription factors and RNA polymerase to describe the relationship between these three components of transcription.

(3 pts.; one point for use of each word correctly)

4. What are two functions of the 5’ cap and the poly A tail on a mature mRNA molecule? (2 pts. for each function; 4 pts. total)

5. In the DNA template strand a codon on the template strand is changed from 3’TTG-‘5 to 3’TTA-5’.

a. What is(are) the amino acid(s) coded for before and after the change? (2 pts.)

b. Does the change from 3’-TTG-5’to 3’-TTA-5’ make a difference in the protein produced? (2 pts.)

Please help this is the last biology assignment I ever have to do and I am on the verge of tears.

c. What if the new codon was a 3’-TTT-5’? Would this make a difference in the protein structure? Explain your answer. (2 pts.)

Expert Solution

Ans1)

Ans a) The mRNA sequence for the gene

5’ – UAUCUAUGGCAUGGCGAUCAUAGAGGCGUG- 3’

This is the mRNA sequence which is formed from the DNA and it is labelled from 5’ to 3’ end. Also the Adenine is complementary to uracil and guanine is complementary to cytosine.

Ans b) AUG is the start codon and UAG is the stop codon. The start codon is the first codon with the messenger RNA where the ribosome starts with the translation process. It is basically a methionine amino acid. The stop codon is UAG where the process of translation stops.

Ans d) The protein sequence which is translated from this is

Met – Arg – Trp – Arg – Ser – Stop

The translation starts with the start codon and stops at the stop codon and this is the amino acid sequence which is formed from the mRNA.

Ans e) The anticodon of the tRNA which will carry the last amino acid is UAG. And this is the stop codon post which the translation will stop

gladiator answered 2 years ago

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and...

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5’ and 3’ polarity. Change the font (where it says paragraph above) to "preformatted" to get a constant-width font the will make your sequence more readable. (3 pts) Use the genetic code to write the N to C sequence of the protein specified by this RNA. Remember that the...

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’...

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’ AUCCGACCGU 3’ 5’ TGCCAGCCTA 3’ 5’ UGCCAGCCUA 3’ Answer question a in the first row (with a number). For statements b-k, enter an X to indicate if it is associated with DNA replication, transcription or translation. A statement may apply to more than one. DNA Replication Transcription Translation Number of template DNA strands? ________ ________ N/A Uses DNA polymerase Uses RNA polymerase Requires ribosomes...

. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence: 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’...

. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence: 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’ After the intron has been removed, what is the likely sequence of the mRNA?

1) You sequence a gene of interest and isolate the matching mRNA. You find that the...

1) You sequence a gene of interest and isolate the matching mRNA. You find that the mRNA is considerably shorter than the DNA sequence. Why is that? a) There was an experimental mistake. The mRNA should have the same length as the gene. b) The mRNA should be longer than the DNA sequence because the promoter is also transcribed. c) The processed mRNA is shorter because introns were removed. d) The mRNA is shorter because the signal sequence to cross...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized from the DNA. (Hint: which strand will you use to build your mRNA?) Then write out the amino acid polypeptide that will be synthesized from this sequence and correctly label the 5’ – 3’ directionality of the mRNA and amino acid fragments: Gene: 5’- A T G C T T C A A G T T G G T C C T C C...

Draw a typical eukaryotic gene. Be sure to include and label the core promoter, some proximal...

Draw a typical eukaryotic gene. Be sure to include and label the core promoter, some proximal promoter elements, one enhancer,transcription start site, two introns, poly(A) addition signal, coding region, and untranslated regions. Below the gene draw a full-length primary transcript of the gene with the 5’ and 3’ ends labeled, and below that draw the final mature mRNA with the ends and coding sequence labeled. Be sure it is clear which parts of the gene are represented in the primary...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is...

1) The WILDTYPE DNA/gene has the base sequence: 5’GTACTGCAT3’ (the antisense strand of the gene is shown) The gene has undergone a mutation. The mutant DNA/gene has the base sequence: 5’GTACTCCAT3’ (the mutation is in BOLD) based on this information, answer the following 1a)What is the base sequence of mutant mRNA? Label the ends of the mRNA 1b) this mutation is most likely to be caused by: a. soot b. analogues c. X-Ray d. RNA polymerase e. ribosome (pick one)...

#1: Gene Transcription and Translation Write a brief statement hypothesizing as to why mRNA is so...

#1: Gene Transcription and Translation Write a brief statement hypothesizing as to why mRNA is so unstable in most bacteria (t1/2 of about 1 minute), when the same half-life is more like 1 hour in higher organisms?

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures? 2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.