Question

In: Biology

Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA,...

Question 1.

Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein.

Question 2.

You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in these faecal samples and what bioinformatic analyses you would undertake.

Solutions

Expert Solution

The protein encoding gene in eukaryote is transcribed as mRNA from DNA by the process of transcription.

During the transcription the one strand of the DNA serve as the template strand for the complemtary base pairing and the whole process of formation of transctription of this template into RNA is catalysed by the enzyme RNA polymerase II. The product formed after this is called pre mRNA.

This pre mRNA is then processed by the process of methylation, capping, and tailing to protect the mRNA from hydrolysis or degradation by the enzymes and pH in nucleus. The product formed after posttranscriptional modification is knoem as mRNA which is a single-stranded copy of the gene, ready for translation into protein.

the diagram suggest the transcription process in detail.

In the process of translation of mRNA into protein, the mRNA is "read" according to the genetic code (triplet codons). 80S ribosome plays an important part on which the codon lies and transfer from A site to the P site. In this way triplet of codon formed which encodes the amino acid lead to the formation of desired protein with the help of peptide bonds.

This diagram is schematic of whole process

2.

For metagenomics of this sample we will process the sample and then extract the whole DNA from the sample. Simultaneously we will process the sample without probiotic. Following process will be done for both the samples.

This will be followed by the digestion of the gene with some known restriction enzyme that suggests the the effect of this probiotic.

The fragments will be then cloned in a vector followed by positive selection.

the positive clones will be sequence by DNA sequencer.

Then by the BLAST analysis on NCBI we will compare the sequences of the clones to the available sequences of the microbes.

The sequences will be the aligned by CLUTAL W in MEGA software followed by phylogenetic analysis.

At final stage we will have a list of microbes present in our gut( in sample with probiotic effect and without probiotic effect). So we will be able to compare the difference of the microflora in the both cases. And we will have a conclusion about the effect of probiotic on microflora of gut.


Related Solutions

1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in these faecal samples...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.Describe the principles behind and the applications of the following: a) Northern blotting b) Site-directed mutagenesis c) DNase l footprinting d) Fusion protein vectors e) Sanger Sequencing of DNA 3.Describe six differences between DNA replication in bacteria compared with eukaryotes.
a) Three nucleotides are inserted into a protein-encoding gene. The insertion occurs such that the mRNA...
a) Three nucleotides are inserted into a protein-encoding gene. The insertion occurs such that the mRNA transcript has an additional 3 bases (NOT a stop) right next to the stop codon (on the 5’ side). Which of the following will be the result? b) Which of the following are consequences of encoding each amino acid using 3 nucleotides in the Genetic Code? (mre than one) A. There are three different reading frames in a single-stranded mRNA B. tRNA anticodons contain...
1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed. •Cis- and...
1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed. •Cis- and Trans-acting elements can u tell me plzz in brief
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’ 5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand ( top / bottom ) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always...
how can a loss-of-function allele in a gene encoding the cohesin protein could be dominant to...
how can a loss-of-function allele in a gene encoding the cohesin protein could be dominant to the wild type allele ?
Explain the process of protein synthesis in detail and how it links to making mRNA
Explain the process of protein synthesis in detail and how it links to making mRNA
Describe the process by which the information in a gene is transcribed and translated into a...
Describe the process by which the information in a gene is transcribed and translated into a protein. Correctly use these words in your description (and highlight them as bold text in your submission): tRNA amino acid start codon transcription mRNA gene codon RNA polymerase ribosome translation anti-codon peptide bond stop codon
A mutation in the gene encoding shugoshin results in a defective shugoshin protein. Which of the...
A mutation in the gene encoding shugoshin results in a defective shugoshin protein. Which of the following could be a potential result in meiosis I? 1) Homologous chromosomes will stay together in meiosis I 2) Cohesin will cause sister chromatids to stick together throughout meiosis 3) Sister chromatids will stick together in meiosis I but not in meiosis II 4) Sister chromatids will separate in meiosis I
What is one way that a mutation in the gene encoding for a wild type protein...
What is one way that a mutation in the gene encoding for a wild type protein that generally binds ligands, prevent this protein from ligand binding?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT