In: Biology
            An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’.
(3 pts.) Write the sequence of template and...
                
            An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’.
- (3 pts.) Write the sequence of template and nontemplate strands
of the gene encoding this mRNA. Clearly indicate which is which and
include 5’ and 3’ polarity. Change the font (where it says
paragraph above) to "preformatted" to get a constant-width font the
will make your sequence more readable.
 
- (3 pts) Use the genetic code to write the N to C sequence of
the protein specified by this RNA. Remember that the Kozak
consensus sequence is GCCACCAUGG.
 
(8 pts) Explain the role or significance of each of the
following in the process of translation:
- 5’ cap:
 
- Kozak consensus sequence:
 
- Stop codon:
 
- Aminoacyl tRNA synthetase:
 
(6 pts) What would be the specific consequence of each of the
following mutations in translation associated molecules?
- Mutation in release factor causes it to bind the sequence
UUU
 
- Loss-of-function mutation in the large ribosomal subunit rRNA
ribozyme
 
- Mutation in initiation factors that causes them to no longer
bind the small ribosomal subunit