An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and...

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’.

(3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5’ and 3’ polarity. Change the font (where it says paragraph above) to "preformatted" to get a constant-width font the will make your sequence more readable.
(3 pts) Use the genetic code to write the N to C sequence of the protein specified by this RNA. Remember that the Kozak consensus sequence is GCCACCAUGG.

(8 pts) Explain the role or significance of each of the following in the process of translation:

5’ cap:
Kozak consensus sequence:
Stop codon:
Aminoacyl tRNA synthetase:

(6 pts) What would be the specific consequence of each of the following mutations in translation associated molecules?

Mutation in release factor causes it to bind the sequence UUU
Loss-of-function mutation in the large ribosomal subunit rRNA ribozyme
Mutation in initiation factors that causes them to no longer bind the small ribosomal subunit

Expert Solution

gladiator answered 2 years ago

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’...

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’ and 3’ ends. (2 pts.) c. Circle the start and stop codons in the sequence you wrote in b. (2 pts.) d. Write the protein sequence translated for this gene. (2 pts.) e. The anticodon of the tRNA which carries the last amino acid will be: ____________ (2 pts.) 2. Write one sentence using the words promoter, transcription factors and RNA polymerase to describe...

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’...

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’ AUCCGACCGU 3’ 5’ TGCCAGCCTA 3’ 5’ UGCCAGCCUA 3’ Answer question a in the first row (with a number). For statements b-k, enter an X to indicate if it is associated with DNA replication, transcription or translation. A statement may apply to more than one. DNA Replication Transcription Translation Number of template DNA strands? ________ ________ N/A Uses DNA polymerase Uses RNA polymerase Requires ribosomes...

the DNA template has the following sequence 5' TGATC 3'. When depurination occurs what sequence would...

the DNA template has the following sequence 5' TGATC 3'. When depurination occurs what sequence would occur in the daughter strand of the altered strand? a. 3' ACTA 5' b. 3' ACTAA 5' c. 3' ACTAG 5' d. 3' AAG 5'

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to...

A sequence of a following DNA template strand 5' - GTAACGGGCACGTCC - 3' was transcribed to an mRNA that was then translated to a protein. What would be the first amino acid in the polypeptide? Assume that no start codon is needed

Slide 11 problem: 5’ UGG 3’ - mRNA -Template DNA stand -Nontemp

Slide 11 problem: 5’ UGG 3’ - mRNA -Template DNA stand -Nontemplate DNA strand Slide 33 problem: The following sequence of nucleotides in a DNA strand was used as a template to synthesize a mRNA that was then translated into protein: 5’-TTAACGGCTTTTTTCCAT-3’ Predict the C-term aa and the N-term aa of the resulting polypeptide. Slide 34 problem: True or False? Explain your answer! 1.An individual ribosome can make only one type of protein. 2.The large and small subunits of an individual...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized from the DNA. (Hint: which strand will you use to build your mRNA?) Then write out the amino acid polypeptide that will be synthesized from this sequence and correctly label the 5’ – 3’ directionality of the mRNA and amino acid fragments: Gene: 5’- A T G C T T C A A G T T G G T C C T C C...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the...

One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures?

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA...

Write the complimentary DNA sequence of the template strand below: 5’-TACGAATGCGCTATGTAAGCT3’ What is the complimentary RNA sequence of the DNA strand above and what is the amino acid sequence? If you have an RNA transcript that is 100 bp, how many codons does it contain? If you take the template DNA that is shown in question 1 and you mutate the 6thnucleotide from A to G how does that impact the polypeptide sequence Is it better to have a mutation...

. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence: 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’...

. The primary transcript (pre-mRNA) of a nuclear gene in chimpanzee has the sequence: 5’-G-exon1 –AGGUAAGCCAGGUC-exon 2-A-3’ After the intron has been removed, what is the likely sequence of the mRNA?

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of...

1. One strand of a double-helical DNA has the sequence 5¢-GCGCAATATTTCTCAAAATATTGCGC-3¢. Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does this double-stranded DNA have the potential to form any alternative structures? 2. Compositional analysis of a certain lipid shows that it has exactly one mole of fatty acid per mole of inorganic phosphate. What could be the identify of this lipid? Explain.

Question