Question

In: Biology

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ 5’ ACGGTCGGAT 3’ 5’...

Which is the mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’

5’ ACGGTCGGAT 3’
5’ AUCCGACCGU 3’
5’ TGCCAGCCTA 3’
5’ UGCCAGCCUA 3’

Answer question a in the first row (with a number).

For statements b-k, enter an X to indicate if it is associated with DNA replication, transcription or translation. A statement may apply to more than one.

	DNA Replication	Transcription	Translation
Number of template DNA strands?	________	________	N/A
Uses DNA polymerase
Uses RNA polymerase
Requires ribosomes
Uses DNA as template
Uses RNA as template
Forms chain of nucleotides
Forms chains of amino acids
Completes entire chromosome at a time
Completes one gene at a time
Requires tRNA is used

The start codon to begin translation is 5’ AUG 3’. Which of the following is the complementary DNA sequence on the template strand?

3’ AUG 5’
3’ TAC 5’
5’ AUG 3’
5’ ATG 3’
5’ TAC 3’

Examine this segment of double stranded DNA. Which is the template strand for transcription?

Strand 1: 5’ A T C T C C T G C C C C T C A T A A 3’

Strand 2: 3’ T A G A G G A C G G G G A G T A T T 5’

What molecule is produced through the process of transcription?

6. What molecule is produced through the process of translation?

7,Translate the following mRNA strand using the codon chart below:

mRNA: 5’ C C A U G U C C C A A C G U C C C G G A A A C U A A 3’

peptide:

Expert Solution

mRNA complement of the DNA sequence 5’ ACGGTCGGAT 3’ - b. 5’ AUCCGACCGU 3’

	DNA replication	Transcription	Translation
a. Number of template strands	2	1	N/A
b. Uses DNA polymerase	X
c. Uses RNA polymerase		X
d. Requires ribosomes			X
e. Uses DNA as template	X	X
f. Uses RNA as template			X
g. Forms chain of nucleotides	X	X
h. Forms chains of amino acids			X
i. Completes entire chromosome at a time	X
j. Completes one gene at a time		X
k. Requires tRNA is used			X

complementary DNA sequence on the template strand for the start codon 5' AUG 3'- b. 3’ TAC 5’

template strand for transcription- strand 1

RNA is produced through the process of transcription.

Protein or peptide (a chain of amino acids) is produced through the process of translation

mRNA: 5’ C C A U G U C C C A A C G U C C C G G A A A C U A A 3’

peptide: Met- Ser- Gln- Arg- Pro- Gly- Asn

gladiator answered 6 months ago

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and...

An mRNA has the sequence 5’ GCCACCAUGGGGGGAAGGUGAAGACC 3’. (3 pts.) Write the sequence of template and nontemplate strands of the gene encoding this mRNA. Clearly indicate which is which and include 5’ and 3’ polarity. Change the font (where it says paragraph above) to "preformatted" to get a constant-width font the will make your sequence more readable. (3 pts) Use the genetic code to write the N to C sequence of the protein specified by this RNA. Remember that the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the...

The following DNA sequence occurs at the start of a DNA strand: 3′—AATTGCAGATTCA—5′. Which of the sequences below would most likely bind to this sequence to initiate DNA replication through the formation of RNA ? A. 5′—TTAACGTCTAAGT—3′ B. 3′—TTAACGTCTAAGT—5′ C. 3′—UUAACGUCUAAGU—5′ D. 5′—UUAACGUCUAAGU—3′

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized...

For the following double stranded DNA sequence, write out the mRNA sequence that will be synthesized from the DNA. (Hint: which strand will you use to build your mRNA?) Then write out the amino acid polypeptide that will be synthesized from this sequence and correctly label the 5’ – 3’ directionality of the mRNA and amino acid fragments: Gene: 5’- A T G C T T C A A G T T G G T C C T C C...

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’...

5'-tatctatggcatggcgatcatagaggcgtg-3' 3'-atagataccgtaccgctagtatctccgcac-5’ a. Write the mRNA sequence for this gene. Be sure to label the 5’ and 3’ ends. (2 pts.) c. Circle the start and stop codons in the sequence you wrote in b. (2 pts.) d. Write the protein sequence translated for this gene. (2 pts.) e. The anticodon of the tRNA which carries the last amino acid will be: ____________ (2 pts.) 2. Write one sentence using the words promoter, transcription factors and RNA polymerase to describe...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which...

The codon in the DNA coding strand has the following sequence: 5' - TAC -3' Which of the following codons (result of a mutation) represents a non-sense mutation? Select one: a. TAA b. TAT c. TTC d. TCC

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA:...

Transcription and Translation 1. Double strand of DNA: 5’-ATGTACCAGCATTCTCGATACCCT-3’ 3’-TACATGGTCGTAAGAGCTATGGGA-5’ mRNA strand made from the DNA: 5’-AUGUACCAGCAUUCUCGAUACCCU-3’ a) Which strand of the DNA is the template for mRNA synthesis? Select the correct answer: i. 5’ – 3’ ii. 3’ – 5’ (0.5 points) b) Draw an arrow on the DNA above, to show the direction of transcription i.e. in which order the nucleotides were added to create mRNA. (0.5 points) c) What is the peptide sequence of this piece of...

Complete the chart below. DNA mRNA 5 ’ &nbsp

Complete the chart below. DNA mRNA 5 ’ 3’ T -- T -- A -- C --- G --- G --- C --- A -- T -- 3’ 5’ Re-state the mRNA strand, write it in the 5’ to 3’ direction. Answer the following questions. mRNA strand: 5’ __________________________ 3’ 8. What is the first codon...

Slide 11 problem: 5’ UGG 3’ - mRNA -Template DNA stand -Nontemp

Slide 11 problem: 5’ UGG 3’ - mRNA -Template DNA stand -Nontemplate DNA strand Slide 33 problem: The following sequence of nucleotides in a DNA strand was used as a template to synthesize a mRNA that was then translated into protein: 5’-TTAACGGCTTTTTTCCAT-3’ Predict the C-term aa and the N-term aa of the resulting polypeptide. Slide 34 problem: True or False? Explain your answer! 1.An individual ribosome can make only one type of protein. 2.The large and small subunits of an individual...