Question

In: Biology

1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...

1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein.

2.Describe the principles behind and the applications of the following:

a) Northern blotting b) Site-directed mutagenesis c) DNase l footprinting d) Fusion protein vectors e) Sanger Sequencing of DNA

3.Describe six differences between DNA replication in bacteria compared with eukaryotes.

Solutions

Expert Solution

1. In eukaryotes, gene has a promoter to which the RNA polymerase binds with the help of various transcription factors to initiate transcription of the gene at a particular transcription site. the mrna produced is henceforth capped with 5 methyl guanosine and tailed with poly adenine tail. In addition the mrna is spliced to remove introns thw non-coding sequences between the coding sequences-exons

2) a) northern blotting is a procedure that identifies a particular segment of DNA. In this procedure the DNA is run on a gel which is then transferred on a nitrocellular membrane where it is hybridised with a probe. The probe has a complimentary sequence of the DNA of interest. The probe is also labelled (fluorescence tag or radio-tag). So when this probe finds its complimentary strand, it binds to it confirming the presence of a particular segment of DNA

b) site directed mutagenesis is a method to see how does a change or deletion or insertion in the particular sequence of the nucleotide

c) DNase I footprinting: in this experiment, the protein is bound to DNA and this protein DNA complex is subjected to digestion by DNase I. These digested fragments are then run on a gel along side the digested strand of DNA which was treated with protein (a control basically). the missing strands in the DNA-protein complex gel are the strands or the stretch where the ptoein basically binds.


Related Solutions

1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in these faecal samples...
Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA,...
Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. Question 2. You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in...
a) Three nucleotides are inserted into a protein-encoding gene. The insertion occurs such that the mRNA...
a) Three nucleotides are inserted into a protein-encoding gene. The insertion occurs such that the mRNA transcript has an additional 3 bases (NOT a stop) right next to the stop codon (on the 5’ side). Which of the following will be the result? b) Which of the following are consequences of encoding each amino acid using 3 nucleotides in the Genetic Code? (mre than one) A. There are three different reading frames in a single-stranded mRNA B. tRNA anticodons contain...
1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed. •Cis- and...
1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed. •Cis- and Trans-acting elements can u tell me plzz in brief
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’ 5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand ( top / bottom ) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always...
how can a loss-of-function allele in a gene encoding the cohesin protein could be dominant to...
how can a loss-of-function allele in a gene encoding the cohesin protein could be dominant to the wild type allele ?
Explain the process of protein synthesis in detail and how it links to making mRNA
Explain the process of protein synthesis in detail and how it links to making mRNA
Describe the process by which the information in a gene is transcribed and translated into a...
Describe the process by which the information in a gene is transcribed and translated into a protein. Correctly use these words in your description (and highlight them as bold text in your submission): tRNA amino acid start codon transcription mRNA gene codon RNA polymerase ribosome translation anti-codon peptide bond stop codon
A mutation in the gene encoding shugoshin results in a defective shugoshin protein. Which of the...
A mutation in the gene encoding shugoshin results in a defective shugoshin protein. Which of the following could be a potential result in meiosis I? 1) Homologous chromosomes will stay together in meiosis I 2) Cohesin will cause sister chromatids to stick together throughout meiosis 3) Sister chromatids will stick together in meiosis I but not in meiosis II 4) Sister chromatids will separate in meiosis I
What is one way that a mutation in the gene encoding for a wild type protein...
What is one way that a mutation in the gene encoding for a wild type protein that generally binds ligands, prevent this protein from ligand binding?
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT