Question

In: Biology

1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed. •Cis- and...

1.Discuss the mechanisms that control the regulation of gene expression, after mRNA is transcribed.

Cis- and Trans-acting elements

can u tell me plzz in brief

Solutions

Expert Solution

1) There are different mechanisms for controlling gene expression at translation level which differ in both prokaryotes and eukaryotes.

Prokaryotes control of gene expression:

i) Translational repressor proteins bind to mRNA and prevent translation.

ii)Antisense mRNA binding to mRNA

iii)Binding of metabolite to a riboswitch in mRNA

Eukaryotes control of gene expression:

i) Phosphorylation of translational intiation factors

ii) Binding of protein to 5' end of mRNA

iii) Antisense RNA binding to mRNA

iv) stability of mRNA can be influenced by RNA binding proteins.

Cis active elements - These elements control gene expression at transcription level. These elements gene are non coding DNA sequences which can regulate transcription of neighboring genes.

Trans active elements- These are also act as controller at transcription level. Unlike cis active element, these elements can control expression of gene distant from gene they have been transcribed. These elements are found to be bind on cis active elements.

If it was helpful give a thumps up


Related Solutions

Explain the regulation of gene expression in eukaryotic cells. Discuss mechanisms by which gene expression may...
Explain the regulation of gene expression in eukaryotic cells. Discuss mechanisms by which gene expression may be altered. How do these alterations induce cancer-causing mutations in cell DNA? Explain how cancer is formed. Describe genetic changes found in cancer cells and how these changes lead to alterations in cell behavior. Determine whether proteome data can be utilized in genetic disorder diagnosis. Relate the Human Genome Project data to the analysis of cancer genes.
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in these faecal samples...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and...
1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. 2.Describe the principles behind and the applications of the following: a) Northern blotting b) Site-directed mutagenesis c) DNase l footprinting d) Fusion protein vectors e) Sanger Sequencing of DNA 3.Describe six differences between DNA replication in bacteria compared with eukaryotes.
Compare and contrast the gene expression regulation mechanisms of prokaryotic and eukaryotic organisms. (essay)
Compare and contrast the gene expression regulation mechanisms of prokaryotic and eukaryotic organisms. (essay)
OPEN QUESTIONS: You are researching mechanisms involved in wdf1 gene expression regulation in yeast 1. Please...
OPEN QUESTIONS: You are researching mechanisms involved in wdf1 gene expression regulation in yeast 1. Please shortly describe how to identify enhancers regulating expression of the wdf1 gene. 2. You have discovered that Wou1 protein is the transcriptional factor that is involved in wdf1 activation. You next goal is to identify other factors, that are interacting with Wou1 protein and are required for wdf1 activation. Please shortly describe experimental approaches to achieve this goal. 3. You have discovered that Wou1...
Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA,...
Question 1. Describe in detail how a protein-encoding gene in a eukaryote is transcribed as mRNA, and what events happen to the mRNA before it can be translated into a protein. Question 2. You want to investigate the effect of a probiotic on your gut microbiome- the population of bacteria living in your digestive tract. You collect faecal samples prior to and after consumption of the probiotic. Describe in detail how you would sequence the metagenome of the bacteria in...
If you wanted to measure expression of DNA at the level of specific transcribed mRNA sequences,...
If you wanted to measure expression of DNA at the level of specific transcribed mRNA sequences, what method could you use? (Describe quantitative reverse-transcription PCR (qRT-PCR).)
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’...
1. The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT5’ 5’ ACTTCGTATAATCATGGCTACAGCTT CGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand ( top / bottom ) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don’t forget that there is always...
.  There are 4 basic mechanisms that control development: (1) Induction; (2) differential gene expression; (3) cell...
.  There are 4 basic mechanisms that control development: (1) Induction; (2) differential gene expression; (3) cell migration; (4) cytoplasmic determinants. Write  an essay describing how each mechanism  is involved in playing out the developmental program.  In your answer first define each mechanism and then describe two examples taken from lecture that illustrate how that method is used in development.
1. Please describe negative control in terms of transcriptional regulation of gene expression? 2. Please explain...
1. Please describe negative control in terms of transcriptional regulation of gene expression? 2. Please explain the regulation of Trp operon when Trp-tRNA is available in the cell? 3. What are the classes of Transcription factors based on their regulatory responsibilities? Please explain if this distinction is absolute or not? 4. Please explain the mitochondrial protein synthesis by indicating the mitochondrial protein synthesis apparatus, the mitochondrial genetic code and so on? 5. Please explain the two hybrid assay? 5. Please...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT