Question

In: Biology

Use the scientific method to come up with, and create your own testable experiment. The experiment...

Use the scientific method to come up with, and create your own testable experiment. The experiment must involve something dealing with cancer, and it must be testable in a lab setting. Remember to include illustrations on how the experiment can be tester. Be sure to include and label your "Observation", "Hypothesis","Experiment", Data & Analyis", & "Conclusion".

Expert Solution

Observation:

Cancer is a disease of multistep, multifactorial and multigenic. The continuing magnitude of cancer problem and the failure of conventional chemotherapy of the advanced invasive disease to effect major reductions in the mortality and morbidity rates for common forms of epithelial malignancy such as carcinoma of lung, colon, breast, prostate and pancreas indicate that new approaches to the control of cancer are critically and essentially needed.

Hypothesis:

Cancer chemoprevention is the main avenue, which offers some sort of beneficial effects. There is considerable scientific evidence to suggest that nutritive and non-nutritive plant-based dietary factors can inhibit the process of carcinogenesis effectively. Any significant role by dietary intervention is encouraging and emerging as an acceptable approach for controlling the cancer incidence worldwide. So the present study to assess the chemopreventive potential of a plant as the model system.

Experiment:

The experimental procedure as follow:

Data analysis:

As for example, I'm giving one of the data for analysis;

(1) Effect of grape juice on various toxicity parameters in liver

Group1

(Control)

Group2

(2.5%)

Group3

(5%)

Group4

(7.5%)

LP

1.153 ±0.053

(1.00)

0.960 ±0.060^b

(0.83)

0.921 ±0.097^a

(0.80)

1.108 ±0.037

(0.96)

LDH

1.696 ±0.081

(1.00)

1.386 ±0.017^a

(0.82)

1.314 ±0.025^a

(0.78)

1.499 ±0.107^b

(0.88)

Values are expressed as mean ± SD of 6-8 animals and values in parentheses represent fold change in parameters assessed (i.e. levels of activity in livers of mice receiving test substance to activity in livers of control mice). Significant changes against the control group of animals and expressed as a – P<0.001, b – P<0.01

Conclusion:

Results obtained from this study show that plant dose administration to mice affects the different enzyme level in the mice liver and kidney. The chemo-modulatory action is due to the induction of phase II enzymes such as lactate dehydrogenase (LDH) and Lipid peroxidase (LP). The results also indicating the significant decrease in lipid peroxidation, which is an indicator of oxidative stress that persists in the cell. The present investigation demonstrated clearly that the plant can be used as a potential cancer chemopreventive agent. It also protects against oxidative stress via the elevation of antioxidative defence enzymes, while significantly reducing the specific activity of lipid peroxidation level.

gladiator answered 1 year ago

For this discussion, come up with your own definition for the terms that refer to a,...

For this discussion, come up with your own definition for the terms that refer to a, "For-profit Enterprise", a "Non-profit Enterprise", and a "Social Enterprise". Feel free to share what you have learned and any relevant facts that you find along the way.

What is a prophet? Come up with one of your own in a sentence or two....

What is a prophet? Come up with one of your own in a sentence or two. In addition to your definition of a prophet, what is it that makes the figure you chose prophetic , and how does his/her story reflect a social justice principle or principles? What is that moves this person to act and speak?

Design and complete a simple experiment using the scientific method. Present a summary of your work....

Design and complete a simple experiment using the scientific method. Present a summary of your work. Your presentation should address all parts of the scientific method. Do not copy an experiment from the internet

Using the scientific method, design your own simple psychological research study and describe it. In your...

Using the scientific method, design your own simple psychological research study and describe it. In your description, please identify: 1. What is your theory? What is your hypothesis? Make sure your theory/hypothesis relates to psychology and involves human participants. 2. What kind of sample will you use? Why? How will you recruit them? 3. Which research design you’ll be using to test your hypothesis (experimental or correlational)? Why did you choose this design? 4. How you will split your participants into...

1) Come up with your own story to illustrate Russel’s paradox informally.

18. State and explain the Coase Theorem. Come up with an example of your own for...

18. State and explain the Coase Theorem. Come up with an example of your own for which the Coase Theorem might best apply and explain how it would happen to solve the externality. Change your scenario in one small way to show how the Coase Theorem would collapse.

how are they come up with "like disslove like"? Is there any scientific explaination how it...

how are they come up with "like disslove like"? Is there any scientific explaination how it works?

For this project you need to come up with five what-ifs. You should use your own house if you have one.

For this project you need to come up with five what-ifs. You should use your own house if you have one. For instance you buy a $500,000 house, put 25% down and finance the rest at 5.5% for 30 years. Now suppose that after 15 years you decide to refinance at 4.7% for 30 years. How much would you save? Now jump to the bottom line and figure how much you save. Is there any ah hah moments? What if...

1. Identify the factors that affect demand. Come up with your own example to illustrate how...

1. Identify the factors that affect demand. Come up with your own example to illustrate how these factors shift demand (do not use examples from the textbook).

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.