Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.

Expert Solution

1. AGTAAACCTACCTGAGACGGG - Point mutation.

A point mutation is a type of mutation in DNA or RNA , in which one single nucleotide base is added deleted or changed. Eg: Sickle cell anaemia.

2. AGTAAACGTACCTGAGACGGG - Normal sequence.

A GTA AAC GTA CCT GAG ACG GG... : +1 Frame shifted translation.

AG TAA ACG TAC CTG AGA CGG G... : -1 Frame shifted translation.

A frameshift mutation is a genetic mutation caused by a deletion or insertion in a DNA sequence that shifts the way the sequence is read. Eg: Tay - Sachs disease.

3. Corresponding RNA Sequence - AGUAAACGUACCUGAGACGGG.

DNA and RNA base pairing is slightly different since DNA uses the base adenine, thymine, cytosine and guanine; RNA uses adenine, uracil, cytosine and guanine.

4. Difference between gene regulation in eukaryotes and prokaryotes.

There are multiple ways gene regulation differs between prokaryotes and eukaryotes. Prokaryotics don't have a true nucleus but eukaryotics do.

So transcription and its regulation in prokaryotics is much simpler. But the eukaryotes have to transcribe and then have a process for mRNA processing like capping, splicing and adding ply adenine tail, and then have a special mechanism to transport the processed mature mRNA to the cytoplasm from the nucleus.
Because prokayotes don't have a nuclear membrane, transcription and translation can occur at opposite ends of the mRNA molecule at the same time. This is not true for eukaryotes.
Transcription is responsible for most gene regulation in prokaryotes but in eukaryotes, gene regulation is more complicated and genes are regulated before and after transcription.
And another difference is that eukaryotes don't express their genes all at once; they express one at a time. Prokaryotes do.
Prokaryotes don't contain introns. So splicing of introns and joining of exons are not needed. But in eukaryotics, splicing of introns and joining of exons is needed.

gladiator answered 2 years ago

Come up with an analogy comparing cytogenetic mapping, to genetic mapping, to DNA sequence mapping. Be...

Come up with an analogy comparing cytogenetic mapping, to genetic mapping, to DNA sequence mapping. Be able to describe it. Don't use a country map as an analogy. an analogy that compares cytogenetic mapping, genetic mapping and dna sequence

1) Come up with your own story to illustrate Russel’s paradox informally.

For this discussion, come up with your own definition for the terms that refer to a,...

For this discussion, come up with your own definition for the terms that refer to a, "For-profit Enterprise", a "Non-profit Enterprise", and a "Social Enterprise". Feel free to share what you have learned and any relevant facts that you find along the way.

What is a prophet? Come up with one of your own in a sentence or two....

What is a prophet? Come up with one of your own in a sentence or two. In addition to your definition of a prophet, what is it that makes the figure you chose prophetic , and how does his/her story reflect a social justice principle or principles? What is that moves this person to act and speak?

1. Identify the factors that affect demand. Come up with your own example to illustrate how...

1. Identify the factors that affect demand. Come up with your own example to illustrate how these factors shift demand (do not use examples from the textbook).

18. State and explain the Coase Theorem. Come up with an example of your own for...

18. State and explain the Coase Theorem. Come up with an example of your own for which the Coase Theorem might best apply and explain how it would happen to solve the externality. Change your scenario in one small way to show how the Coase Theorem would collapse.

Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAG

Compare to this DNA sequence: 1. Forward sequence: GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC Reverse sequence: ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA

Instructions: 1. Come up with two example data sets of your own whose standard deviations would...

Instructions: 1. Come up with two example data sets of your own whose standard deviations would be interesting to compare. Some examples: a) Potato weights vs onion weights. b) Female heights vs male heights c) National league batting averages vs American league batting averages An example that doesn't work: GPAs vs SATs. These are two different variables that even use different units. So comparing their standard deviations is meaningless. However, male GPA vs female GPA would be a valid comparison....

1. In 3 to 4 sentences, come up with your own personal ethical principle/philosophy which upholds...

1. In 3 to 4 sentences, come up with your own personal ethical principle/philosophy which upholds over the years. 2. What other ethical principle/philosophy you want to embrace as ypu grow older? State it in 2 to 4 sentences.

Use the scientific method to come up with, and create your own testable experiment. The experiment...

Use the scientific method to come up with, and create your own testable experiment. The experiment must involve something dealing with cancer, and it must be testable in a lab setting. Remember to include illustrations on how the experiment can be tester. Be sure to include and label your "Observation", "Hypothesis","Experiment", Data & Analyis", & "Conclusion".

Question