What is a prophet? Come up with one of your own in a sentence or two....

What is a prophet? Come up with one of your own in a sentence or two.

In addition to your definition of a prophet,

what is it that makes the figure you chose prophetic

, and how does his/her story reflect a social justice principle or principles?

What is that moves this person to act and speak?

Expert Solution

Step -1

A person who us speak for God and a teacher who give best guidence to lead our life happily.

Prophet is messenger of God.he reaches the pricious advice and wisdom of words of God to common people for bot distrat from right path and not to surrender of evil.

Step:2 prophetic will be a person who is omnious, omnipotent and give prediction of future and to speak in God prespctive., Able to manifest emotion and derp feeling in heart of common people for God.

Step 3 :the founder of Islam prophet Mohammad was brings revoulationzed and restructure the society .his life history relflect following principal of Social justice

1.freedom of religious where everyone is to choose practice religious according his own interests and no compulsion will be there for transfer into own religions of peope

2.racial equally was there.no one will be discriminate on the basis of colour .

3.Education is most powerful weapon to change the world.so everyone is deserve to receive .he told education should be continue cradle to grave.

4.women are equal of men .wome are equal rights to man in every aspect of life .so prophet history of life never denied women rights

1

Hayet Jeridi answered 1 year ago

Come up with your own example of one dependent and one compound event. Give specific numbers....

Come up with your own example of one dependent and one compound event. Give specific numbers. Do not calculate probabilities. Just site the event.

For this discussion, come up with your own definition for the terms that refer to a,...

For this discussion, come up with your own definition for the terms that refer to a, "For-profit Enterprise", a "Non-profit Enterprise", and a "Social Enterprise". Feel free to share what you have learned and any relevant facts that you find along the way.

For this project you need to come up with five what-ifs. You should use your own house if you have one.

For this project you need to come up with five what-ifs. You should use your own house if you have one. For instance you buy a $500,000 house, put 25% down and finance the rest at 5.5% for 30 years. Now suppose that after 15 years you decide to refinance at 4.7% for 30 years. How much would you save? Now jump to the bottom line and figure how much you save. Is there any ah hah moments? What if...

Instructions: 1. Come up with two example data sets of your own whose standard deviations would...

Instructions: 1. Come up with two example data sets of your own whose standard deviations would be interesting to compare. Some examples: a) Potato weights vs onion weights. b) Female heights vs male heights c) National league batting averages vs American league batting averages An example that doesn't work: GPAs vs SATs. These are two different variables that even use different units. So comparing their standard deviations is meaningless. However, male GPA vs female GPA would be a valid comparison....

1) Come up with your own story to illustrate Russel’s paradox informally.

18. State and explain the Coase Theorem. Come up with an example of your own for...

18. State and explain the Coase Theorem. Come up with an example of your own for which the Coase Theorem might best apply and explain how it would happen to solve the externality. Change your scenario in one small way to show how the Coase Theorem would collapse.

Use the scientific method to come up with, and create your own testable experiment. The experiment...

Use the scientific method to come up with, and create your own testable experiment. The experiment must involve something dealing with cancer, and it must be testable in a lab setting. Remember to include illustrations on how the experiment can be tester. Be sure to include and label your "Observation", "Hypothesis","Experiment", Data & Analyis", & "Conclusion".

1. Identify the factors that affect demand. Come up with your own example to illustrate how...

1. Identify the factors that affect demand. Come up with your own example to illustrate how these factors shift demand (do not use examples from the textbook).

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...

Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.

YOUR OWN original study idea. I want each individual group member to come up with their...

YOUR OWN original study idea. I want each individual group member to come up with their own original study idea. You’ll turn in this original idea with your final assignment. Original Study Idea Null hypothesis Alternative hypothesis IVs DVs Best test to use Results Write-Up

Question