Question

In: Advanced Math

1) Come up with your own story to illustrate Russel’s paradox informally.

1) Come up with your own story to illustrate Russel’s paradox informally.

Solutions

Expert Solution

Russell's paradox is based on examples like this: Consider a group of barbers who shave only those men who do not shave themselves. Suppose there is a barber in this collection who does not shave himself; then by the definition of the collection, he must shave himself. But no barber in the collection can shave himself. (If so, he would be a man who does shave men who shave themselves.)

Russell's paradox, which he published in Principles of Mathematics in 1903, demonstrated a fundamental limitation of such a system. In modern terms, this sort of system is best described in terms of sets, using so-called set-builder notation. For example, we can describe the collection of numbers 4, 5 and 6 by saying that x is the collection of integers, represented by n, that are greater than 3 and less than 7. We write this description of the set formally as x = { n: n is an integer and 3 < n < 7} . The objects in the set don't have to be numbers. We might let y ={x: x is a male resident of the United States }.

Seemingly, any description of x could fill the space after the colon. But Russell (and independently, Ernst Zermelo) noticed that x = {a: a is not in a} leads to a contradiction in the same way as the description of the collection of barbers. Is x itself in the set x? Either answer leads to a contradiction.

When Russell discovered this paradox, Frege immediately saw that it had a devastating effect on his system. Even so, he was unable to resolve it, and there have been many attempts in the last century to avoid it.


Related Solutions

1. Identify the factors that affect demand. Come up with your own example to illustrate how...
1. Identify the factors that affect demand. Come up with your own example to illustrate how these factors shift demand (do not use examples from the textbook).
For this discussion, come up with your own definition for the terms that refer to a,...
For this discussion, come up with your own definition for the terms that refer to a, "For-profit Enterprise", a "Non-profit Enterprise", and a "Social Enterprise". Feel free to share what you have learned and any relevant facts that you find along the way.
Please read the following made up story and come up with 1 1/2-2 page resolution to...
Please read the following made up story and come up with 1 1/2-2 page resolution to the story Keeping organizations properly succeeding is vital in our mission at OTC (Organizational Theory Consultants). We pride ourselves in being able to upright the most complex of situations involving various organizations needing a turn around to keep from failing in their specific industry. Organizations need to have their culture running like a well oiled machine to avoid any hiccups which can have a...
What is a prophet? Come up with one of your own in a sentence or two....
What is a prophet? Come up with one of your own in a sentence or two. In addition to your definition of a prophet, what is it that makes the figure you chose prophetic , and how does his/her story reflect a social justice principle or principles? What is that moves this person to act and speak?
18. State and explain the Coase Theorem. Come up with an example of your own for...
18. State and explain the Coase Theorem. Come up with an example of your own for which the Coase Theorem might best apply and explain how it would happen to solve the externality. Change your scenario in one small way to show how the Coase Theorem would collapse.
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point...
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGGG Explain how gene regulation in eukaryotes differs from gene regulation in prokaryotes.
Instructions: 1. Come up with two example data sets of your own whose standard deviations would...
Instructions: 1. Come up with two example data sets of your own whose standard deviations would be interesting to compare. Some examples:    a) Potato weights vs onion weights.    b) Female heights vs male heights    c) National league batting averages vs American league batting averages An example that doesn't work: GPAs vs SATs. These are two different variables that even use different units. So comparing their standard deviations is meaningless. However, male GPA vs female GPA would be a valid comparison....
1. In 3 to 4 sentences, come up with your own personal ethical principle/philosophy which upholds...
1. In 3 to 4 sentences, come up with your own personal ethical principle/philosophy which upholds over the years. 2. What other ethical principle/philosophy you want to embrace as ypu grow older? State it in 2 to 4 sentences.
Use the scientific method to come up with, and create your own testable experiment. The experiment...
Use the scientific method to come up with, and create your own testable experiment. The experiment must involve something dealing with cancer, and it must be testable in a lab setting. Remember to include illustrations on how the experiment can be tester. Be sure to include and label your "Observation", "Hypothesis","Experiment", Data & Analyis", & "Conclusion".
Write in Python. come up with a programming task for which you will write your own...
Write in Python. come up with a programming task for which you will write your own program. It should be a purposeful and non-trivial program, bigger than any programming assignment. But it should not be something too ambitious that you may not end up finishing by the deadline. The program must not be something available on the Internet or in a book. The program must satisfy the following five requirements: It must define and appropriately use at least one class....
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT