Draw what a parent and daughter strand of DNA would look like before DNA ligase is...

Draw what a parent and daughter strand of DNA would look like before DNA ligase is added to the reaction, but after DNA Poly I was added..

Expert Solution

1. DNA polymerase only can make DNA in the 5' to 3' direction.

2. In a parental DNA double helix is in anti-parallel orientation, because of this DNA polymerase make two new daughter strands.

3. One new strand is continues and runs 5' to 3' direction towards the replication fork forms leading strand.

4. The other new strand is discontinuous runs 5' to 3' away from the fork from fragments of DNA called lagging strand.

5. These small fragments of daughter DNA are called Okazaki fragments. The gaps between DNA fragments are sealed by DNA ligase.

6. This is clearly show in the below picture before and after adding ligase to the reaction.

gladiator answered 2 years ago

What DNA products would be generated if one of the proteins including DNA polymerase, DNA ligase,...

What DNA products would be generated if one of the proteins including DNA polymerase, DNA ligase, sliding clamp for DNA polymerase, nuclease that removes DNA primers, DNA helicase, and primase, were missing?

1. What would the complementary strand of DNA be for these strands of DNA? (1 point...

1. What would the complementary strand of DNA be for these strands of DNA? (1 point each; 5 points total) a. 5’ – AGCTTGCATGGCTATT – 3’ b. 3’ – GCAATGGGCGCT – 5’ c. 3’ – AAATCCGATGCGCTA – 5’ d. 5’ – GCAGCAGCATTGCA – 3’ e. 3’ – GCAATCGCCGGTGCAC – 5’ 3 During what portion of the cell cycle does DNA replicate? How many times does DNA replicate before mitosis? How many times does DNA replicate before meiosis? (3 points) 4...

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3'...

1. Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' 2. How many amino acids would the RNA molecule code for?

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends...

Given the non-template strand of DNA, draw the template strand with the 5' and 3' ends labeled. Draw the RNA molecule with the proper 5' and 3' ends labeled Non-Template Strand: 3'- AAT GCT CGT AGC TTC GAT CGG ATC GA-5' My answers: Template= 5'- TAT CGA GCA TCG AAG CTA GCC TAG CT-3' RNA Molecule= 3'- AUA GCU CGU UGC UUC GAU CGG AUC GA-5' Next it asks, how many amino acids would the RNA molecule code for? -...

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below....

Write sequence of the DNA strand that would be complementary to the DNA sequence shown below. Label the 3' and 5' ends ofthe new strand. 3' T A C C G A T G G 5'

What is the difference between the enzymes DNA polymerase I and ligase? Select one: a. DNA...

What is the difference between the enzymes DNA polymerase I and ligase? Select one: a. DNA polymerase I binds to Okazaki fragments, removes the primers, and replaces them with DNA nucleotides. b. Ligase binds to Okazaki fragments, removes the primers, and replaces them with DNA nucleotides. c. DNA polymerase I attaches the fragments to make one single continuous strand. d. Ligase attaches the Okazaki fragments to make one single continuous strand. e. Both A and D are correct. f. Both...

1045 Steel (quenched specimen) Draw a picture of what you think the microstructure would look like...

1045 Steel (quenched specimen) Draw a picture of what you think the microstructure would look like and label the constituents (martensite, ferrite, cementite or whatever you expect to find in this quenched specimen). Include the figure number.

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA...

Given the sequence below 5’ AACTTCGGCTTAAATGGAGGCCAT’ What is the complementary DNA strand? What would the mRNA strand look like? What would the protein look like? Create a point mutation in the DNA and then give the mRNA and protein sequence. Create a frameshift mutation in the DNA and then give the mRNA and protein sequence.

What is the approximate rate of addition of nucleotides to a strand of DNA during DNA...

What is the approximate rate of addition of nucleotides to a strand of DNA during DNA replication in eukaryotes? What is the approximate size of the human genome in terms of base pairs? Which enzyme is responsible for adding nucleotides to a strand of DNA during DNA replication?

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of...

Given the sequence 5’-AGTTACCTGA-3’ what would be the sequence of the complementary DNA strand? Which of the following? 5’-TCAATGGACT-3’ 3’-AGTTACCTGA-5' ’5’-AGTTACCTGA-3’ 3’-TCAGGTAACT-5’ 5’-TCAGGTAACT-3’

Question