Question

Knockout mice are created by incubating embryonic stem (ES) cells with a DNA construct that contains a portion of the gene with a disrupted exon. The exon is disrupted by inserting a gene for neomycin resistance (neo^r) into the exon. When the DNA construct carrying the disrupted exon is taken up by an ES cell, a knockout allele results when the added DNA construct

(a)        replicates as an independent DNA molecule in the ES cell and is maintained in all cells derived from it.

(b)       undergoes homologous recombination with the wild type allele of the gene in the ES cell.

(c)        inserts randomly in the genome of the ES cell.

(d)       is processed in the ES cell such that the neo^r gene is excised and pasted at random sites in the genome of the ES cell.

Depending on the vector used for gene therapy, the therapeutic gene can integrate into the chromosome or it can stay as an extrachromosomal piece of DNA (episome). Some long-lived cells (for example, neurons, myocytes, hepatocytes) can have stable long-term expression of the therapeutic gene without integration of the introduced gene into the host genome. Which vectors will be most suitable for introduction of a gene into long-lived cells, where the introduced gene does not integrate into the host genome?

(a) Vectors derived from retroviruses

(b)       Vectors derived from Adeno-associated viruses (AAVs)

(c)        Vectors derived from plant viruses

(d)       Vectors derived from bacterial viruses

For genome editing of a crop plant by CRISPR-Cas9, you have designed a sgRNA (single guide RNA) that contains a sequence that recognizes the target sequence in the genome of the plant, and a region that binds to the Cas9 protein. Given the following target sequence in the genome, the sequence of the sgRNA that recognizes the target sequence is ______________________________. Binding of the sgRNA-Cas9 complex to the target site will lead to a ______________ (single or double)-stranded cut in the DNA. Fill in the blanks using the following choices.

3’-------------GATCGGATCGATGGAACAGA-------------5’

     5’-------------CTAGCCTAGCTACCTTGTCT-------------3’

(a)        3’ – CUAGCCUAGCUACCUUGUCU – 5’; single

(b)       3’ – CUAGCCUAGCUACCUUGUCU – 5’; double

(c)        5’ – CUAGCCUAGCUACCUUGUCU – 3’; single

(d)       5’ – CUAGCCUAGCUACCUUGUCU – 3’; double

Answer 1

1. Option a is incorrect because if it replicates independently then it does not perform the function of making or make a gene inoperative.

Option b is correct bacsuse the added DNA construct during knockout is carried out by the process of homologous recombination.This is done by electroporation or lipofection process wherein the mechanism happens.

Option c is incorrect because random insertion will may disrupt other genes and their function

Option d is incorrect because of the same reason as c

Therefore option b is the right answer.

2.Of the given vectors retrovirus,plant viruses and those derived from the bacterial viruses have shown to integrate into the host genome.Integration into host genome does not take place where adeno viruses are used.

Therefore,option b is the right answer.

3.The sequence of sgRNA that recognizes the sequences will be in the polarity 5'-3' and for the given sequence is :

5’ – CUAGCCUAGCUACCUUGUCU – 3’

.And this will lead to a double stranded cut by undergoing various conformational changes and breaks the opposite strands.

Therefore,combining these two option d is the correct answer.