In: Biology
Diseases due to lack of gangliosides are..
Malfunctioning of some channels leads to diseases. Give some specific examples. And mechanism.
Multi-drug resistant : why does it occur?
http://www.guidetopharmacology.org/GRAC/ReceptorFamiliesForward?type=IC
The blood-brain barrier. How does it work/
Many Psychoactive Drugs Act at Synapses : what are their targets
Gunter Blobel : some of his major findings were……
In: Biology
A.) List two general ways that phosphorylation by a kinase can promote intracellular signaling?
B.) Explain why, in the absence of inhibitor, epinephrine stimulation results in the presence of beta arrestin band, which is absent in inhibitor treated samples.
In: Biology
What are the physical and chemical properties of the following oils:
- Almond oil
- Fish oil
- Coconut oil
- Palm Kernel oil
Please provide the website where you get your information. Thank you.
In: Biology
Phenol red, a pH indicator, is used in the experiment to determine respiration activity by showing CO2 production.
|
Table: CO2 Production by Beans |
||
|
Beans |
Indicator Color (Phenol Red) |
Conclusion (CO2 present or absent) |
|
Germinating |
Yellow |
Present |
|
Ungerminated-dry |
Red |
Absent |
Questions;
1. How does phenol red work as a pH indicator?
2. Why does this show respiration activity?
In: Biology
1.Symbiosis means “living together” and we talked about several types of symbiotic interactions that happen in communities. Name ONE type of symbiotic interaction and give me an example.
2.What happens to energy as it moves through the trophic levels of an ecosystem? What happens to nutrients as they move through an ecosystem?
In: Biology
One likely reason that only microbes existed for the first two billion years of life is
a) high concentrations of ozone in the stratosphere.
b) the absence of nitrogen in the environment at the time.
c) the toxicity of oxygen to multicellular organisms.
d) high levels of iron oxide in the water.
e) low concentrations of O2 at that time.
In: Biology
. Imagine you are studying a new cooperative breeding vertebrate species and you find that groups of females can be either related or unrelated. What would you predict in terms of group size (larger or smaller) and reproductive skew (more or less) in these different types of groups. Explain your reasoning.
In: Biology
Please make an article about implementation of good manufacturing practice in food industry. Must be 500-700 words
In: Biology
a) What is the role of studies of other organisms in understanding the organization and development of the nervous system?
b) What is the advantage for a species of developmental, individual variation?
In: Biology
1. Some bacteria can stop the activation of complement. Suggest 2 things bacteria might do to complement proteins to stop or prevent complement activation. Describe how stopping complement activation would protect the bacteria.
In: Biology
What is the role of plasticity in development of the individual? How can two individuals with identical genotypes exhibit different phenotypes?
In: Biology
In eurkaryote transcription, what is an exon and interon, and what is 5 capping and poly A tailing?
In: Biology
What are different mechanisms through which genetic variation occurs? Describe the mechanism in detail in which a specialized plasmid plays a role for genetic variation to occur.
In: Biology
1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold “G”.
a) Underline the promoter region of this gene by a dotted line.
b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box?
c) Deduce the nucleotide sequence of mRNA for this gene.
d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino
acids does this mRNA code for? What is the sequence of the codons in this mRNA?
e) Show 5’ and 3’ ends of the template strand and mRNA.
f) What are the -10 and +10 base pairs of this gene?
CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA
In: Biology