Questions
The children of a 76-year-old man when visiting him noticed that he was more forgetful and...

The children of a 76-year-old man when visiting him noticed that he was more forgetful and had
trouble walking. Concerned that he had suffered a stroke,
they insisted that he visit his doctor. The doctor diagnosed him with peripheral neuropathy
that his ability to walk affected him. In addition, the doctor noticed that he was pale, a
little yellow, and I order a CBC and some additional tests.


1. What findings at the CBC told the doctor to order vitamin tests?

2. Was the response in number of reticulocytes adequate to compensate for the degree of anemia? Explain

3. Does the patient present a hemolytic picture? Yes or no, explain your answer based on the results.

4. in the results, what concludes about the cause of anemia?

5. What additional tests could help diagnose the specific cause of the patient's anemia?

In: Biology

Diseases due to lack of gangliosides are.. Malfunctioning of some channels leads to diseases. Give some...

Diseases due to lack of gangliosides are..

Malfunctioning of some channels leads to diseases. Give some specific examples. And mechanism.

Multi-drug resistant : why does it occur?

http://www.guidetopharmacology.org/GRAC/ReceptorFamiliesForward?type=IC

The blood-brain barrier. How does it work/

Many Psychoactive Drugs Act at Synapses : what are their targets

Gunter Blobel : some of his major findings were……

In: Biology

A.) List two general ways that phosphorylation by a kinase can promote intracellular signaling? B.) Explain...

A.) List two general ways that phosphorylation by a kinase can promote intracellular signaling?

B.) Explain why, in the absence of inhibitor, epinephrine stimulation results in the presence of beta arrestin band, which is absent in inhibitor treated samples.

In: Biology

What are the physical and chemical properties of the following oils: - Almond oil - Fish...

What are the physical and chemical properties of the following oils:

- Almond oil

- Fish oil

- Coconut oil

- Palm Kernel oil

Please provide the website where you get your information. Thank you.  

In: Biology

Phenol red, a pH indicator, is used in the experiment to determine respiration activity by showing...

Phenol red, a pH indicator, is used in the experiment to determine respiration activity by showing CO2 production.

Table:   CO2 Production by Beans

Beans

Indicator Color

(Phenol Red)

Conclusion

(CO2 present or absent)

Germinating

Yellow

Present

Ungerminated-dry

Red

Absent

Questions;

1. How does phenol red work as a pH indicator?

2. Why does this show respiration activity?

In: Biology

1.Symbiosis means “living together” and we talked about several types of symbiotic interactions that happen in...

1.Symbiosis means “living together” and we talked about several types of symbiotic interactions that happen in communities. Name ONE type of symbiotic interaction and give me an example.

2.What happens to energy as it moves through the trophic levels of an ecosystem? What happens to nutrients as they move through an ecosystem?

In: Biology

One likely reason that only microbes existed for the first two billion years of life is...

One likely reason that only microbes existed for the first two billion years of life is

a) high concentrations of ozone in the stratosphere.

b) the absence of nitrogen in the environment at the time.

c) the toxicity of oxygen to multicellular organisms.

d) high levels of iron oxide in the water.

e) low concentrations of O2 at that time.

In: Biology

. Imagine you are studying a new cooperative breeding vertebrate species and you find that groups...

. Imagine you are studying a new cooperative breeding vertebrate species and you find that groups of females can be either related or unrelated. What would you predict in terms of group size (larger or smaller) and reproductive skew (more or less) in these different types of groups. Explain your reasoning.

In: Biology

Please make an article about implementation of good manufacturing practice in food industry. Must be 500-700...

Please make an article about implementation of good manufacturing practice in food industry. Must be 500-700 words

In: Biology

a) What is the role of studies of other organisms in understanding the organization and development...

a) What is the role of studies of other organisms in understanding the organization and development of the nervous system?

b) What is the advantage for a species of developmental, individual variation?

In: Biology

1. Some bacteria can stop the activation of complement. Suggest 2 things bacteria might do to...

1. Some bacteria can stop the activation of complement. Suggest 2 things bacteria might do to complement proteins to stop or prevent complement activation. Describe how stopping complement activation would protect the bacteria.

In: Biology

What is the role of plasticity in development of the individual? How can two individuals with...

What is the role of plasticity in development of the individual? How can two individuals with identical genotypes exhibit different phenotypes?

In: Biology

In eurkaryote transcription, what is an exon and interon, and what is 5 capping and poly...

In eurkaryote transcription, what is an exon and interon, and what is 5 capping and poly A tailing?

In: Biology

What are different mechanisms through which genetic variation occurs? Describe the mechanism in detail in which...

What are different mechanisms through which genetic variation occurs? Describe the mechanism in detail in which a specialized plasmid plays a role for genetic variation to occur.

In: Biology

1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated...

1) The following DNA strand is a template strand of a prokaryotic gene.Transcription start siteis indicated by a bold “G”.

a) Underline the promoter region of this gene by a dotted line.

b)Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box?

c) Deduce the nucleotide sequence of mRNA for this gene.

d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino

acids does this mRNA code for? What is the sequence of the codons in this mRNA?

e) Show 5’ and 3’ ends of the template strand and mRNA.

f) What are the -10 and +10 base pairs of this gene?

CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA

In: Biology