What are the differences between protein expression in prokaryotic organisms vs. eukaryotic organisms

QUESTION 3

(A) In dairy production, what do you understand by the term ‘lactation cycle’? (1 Mark)

(B) Mention the four (04) phases of the lactation cycle and highlight the specific time periods when these phases occur in dairy cows (4 Marks)

(C) Explain how milk production varies in the different phases of the lactation cycle (4 Marks)

(D) Relate the milk production to the feed intake and body weight of the dairy cow during the four phases of the lactation cycle (8 Marks)

(E) Briefly explain the term ‘negative energy balance’ and when does this normally happen in dairy cows (2 Marks)

(F) What is the recommended time of servicing the dairy cow during her lactation cycle?

please provide information about Taxus baccata  in your own words at least 50

including

physical characteristics ,reproduction ,Relationship with Humans, Fun Facts

please provide information about bambusa in your own words at least 50

including

description, physical characteristics ,reproduction ,Relationship with Humans, Fun Facts

please provide information about Gnetophyta in your own words at least 50

including

physical characteristics ,reproduction ,Relationship with Humans, Fun Facts

Explain the function of the sarcoplasmic reticulum and T tubules in skeletal muscle contraction.

Summary:

Answer the following questions in detail. You have three hours to complete the final exam.

Question 1:

Student life is full of stressors. Give three sources of stress and explain how they affect students’ academic performance.

Question 2:

Time management is one way colege students can use to reduce stress. Give three time management techniques and explain how they can halp students manage their time better and improve their academic performance.

·     A strain of yeast requiring both tyrosine (tyr-) and arginine (arg-) is crossed to the wild type. After meiosis, the following 10 asci are dissected. Classify each ascus as to the segregational type (PD, NPD, TT). What is the linkage relationship between these two loci?

1             arg-tyr-                arg+tyr+               arg+tyr+               arg-tyr-

2             arg+tyr+               arg+try+               arg-tyr-                arg-tyr-

3             arg-tyr+               arg-tyr+               arg+tyr-               arg+tyr-

4             arg-tyr-                arg-tyr-                arg+tyr+               arg+tyr+

5             arg-tyr-                arg-tyr+               arg+tyr-               arg+tyr+

6             arg+tyr+               arg+tyr+               arg-tyr-                arg-tyr-

7             arg-tyr-                arg+tyr+               arg-tyr+               arg+tyr-

8             arg+tyr+               arg+tyr+               arg-tyr-                arg-tyr-

9             arg+tyr+               arg-tyr-                arg-tyr-                arg+tyr+

10           arg-tyr-                arg+tyr+               arg+tyr+               arg-tyr-

Regarding an epidemiological outbreak ,discuss the four major routes by which pathogens spread.Also, discuss methods that one would introduce to stop the spreading of pathogens

1) Given your understanding of transcription and translation, fill in the items below with the proper sequences. Please align your answers under the nontemplate DNA strand. Ignore RNA stop codons if they are present.

Nontemplate strand of DNA:                 5′- A T G T A T G C C A A T G C A -3′

     Template strand of DNA:       

                                 RNA:       

             Anticodons on tRNA:      

            Amino acid sequence:

2) Original template strand of DNA:  3′- T A C G C A A G C A A T A C C G A C G A A -5′

a. Transcribe this sequence:

                                      RNA:

b. Translate the RNA sequence. Ignore start/stop codons if present.

                 Amino acid sequence:

3) The table below lists five single-base point mutations that may occur in DNA. What happens to the amino acid sequence as a result of each mutation? (Position 1 refers to the first base at the 3′ end of the DNA strand. Position 21 would refer to the last base at the 5’ end.). Note that amino acids are numbered from L à R as 1-7.

Original template strand:  3’ TACGCAAGCAATACCGACGAA 5’

                   RNA strand:

     Amino acid sequence:                                                            (number aa’s 1-7 L-R)