Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse
and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up.
-----
Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis?
5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’
3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’
a) 5’ GGAAAATTCAGATCTTAG 3’;
5’ TGGGCAATAATGTAGCGC 3’
b) 5’ GCTAAGATCTGAATTTTC 3’;
3’ ACCCGTTATTACATCGCG 5’
c) 3’ GATTCTAGACTTAAAAGGC 5’;
3’ ACCCGTTATTACATCGCG 5’
d) 5’ GCTAAGATCTGAATTTTC 3’;
5’ TGGGCAATAATGTAGCGC 3’.
In: Biology
Greg Wilson, a 65-year-old man, is diagnosed with pneumonia. He has a history of congestive heart failure. His physician has ordered an antibiotic for the pneumonia and he takes digoxin every day.
As the health care provider, which question would you
ask first before administering his antibiotic? Why is the first
dose of the antibiotic twice as much as the maintenance dose? Which
variables may slow his metabolism and excretion?
In: Biology
Which group is the furthest from the other two, evolutionarily-speaking?
-Eukarya
-Archaea
-Bacteria
In: Biology
You are a researcher in a biochemistry lab which investigates a novel, globular protein production by yeast. The director of the lab asks you to produce and purify the protein. Unfortunately, you could not obtain any information about if the protein is extracellular or intracellular. Within this scope, please propose a method/methods for isolating the protein after the production process. You have a well-equipped laboratory with the equipment would require to isolate and purify. In addition describe an experiment or set of experiments to prove (or disprove) the protein is composed of more than one subunit.
In: Biology
To date, which is the most biomes is evected by the human?
In: Biology
4. List 5 examples of tropical fruits, including their family, Latin binomial, and a distinguishing feature.
In: Biology
Part A: In a disputed parentage case, the child is blood type O, while the mother is blood type O. What are the possible blood type(s) for the father?
Select all that apply.
O
B
A
AB
Part B: If the child is blood type B, while the mother is blood type O. What blood type would exclude a male from being the father?
Select all that apply.
AB
A
B
O
In: Biology
6. Assessing the population size of organisms is important in determining whether a species requires special conservation effort and in helping to manage sustainable harvesting of food.
a) Why is it important to determine the uncertainty surrounding an estimate of population size? (1 mark)
b) Using an example species and method of population size estimation, explain how you would assess the quality of your population size estimate.
c) Estimating the size of fish species’ populations is very difficult. Imagine that you discovered a new species of fish that appeared to be highly abundant. Given that you probably can’t obtain a reliable population estimate for the species, what other information would you consider when devising a harvesting strategy?
In: Biology
What is the role of acetylation in terms of histones and gene expression?
In: Biology
Please answer and I will give good rating
You have identified a new species of fruit fly and adults have 6 chromosomes. You also discover that this species performs mitosis and meiosis as other eukaryotes. Based on this information how many chromosomes will you expect to find in the following cells.
Mitotic cells just entering G1
Meiotic cells just entering G2
Meiotic cells having completed MI
Mitotic cells during anaphase
Meiotic cells during anaphase II
In: Biology
Describe how a child with one blue eye and one brown eye can be explained through X inactivation. Include the mechanisms involved.
In: Biology
An annotated diagram that identifies a possible treatment and explains the steps needed to apply the treatment for Asthma.
In: Biology
Red-green color blindness is due to an X-linked recessive allele in humans. A widow’s peak (a hairline that comes to a peak in the middle of the forehead) is due to an autosomal dominant allele.
Consider the following family history:
The man’s father had a straight hairline, as did both of the woman’s parents.
Use the family history to make predictions about the couple’s children.
Drag the correct label to the appropriate location in the table. Not all labels will be used.
1. If the couple has a child, what is the chance that it will be a son with a widow's peak?
2. What is the chance that any son the couple has will be color blind with a straight hairline?
3. What is the chance that any daughter the couple has will be colorblind with a widow's peak?
4. Suppose the couple had a daughter with normal color vision and a widow's peak. What is the chance that she is heterozygous for both genes?
View Available Hint(s)
|
Reset Help 11 3/43/4 1/41/4 1/21/2 0 |
In: Biology
For which experiment will you create a standard curve, using absorbancy, or a pre-defined scale?
a.Benedic'ts test
b.Iodine test
c.Biuret test
d.Sudan test
In: Biology
Describe the process of mitosis, and its role in the cell life cycle.
In: Biology