In detail describe the function of centrosomes in mitosis as well as how extra centrosomes are able to cause aneuploidy.

Part A: What is the probability of producing and F1 offspring that phenotypically resemble either parent from the cross?

AaBbCC x aabbCc

Note: Assume that capital letters represent completely dominant alleles.

Part B: Same cross. But in this case the alleles are incompletely dominant. What is the probability of producing and F1 offspring that phenotypically resemble either parent from the cross?

Experiment 2 – Light Independent Reaction

After the light dependent reaction, the light independent takes place. During this phase, also known as the Calvin Cycle, the energy generated in the light independent phase is used to fixate the carbon atoms from carbon dioxide and glucose is produced.

In this experiment you will use baby spinach leaves to demonstrate the utilization of carbon dioxide during the light independent reaction of photosynthesis. Phenol red is an organic dye that undergoes a color change according to pH . The color of this compound will appear as follows:

Because phenol red can be used to detect changes in pH, it can also be used as an indirect method of detecting changes in the amount of CO2 dissolved in a solution. When CO2 is added to a solution, some of it reacts with water to produce an acid called carbonic acid. In turn, some of the carbonic acid dissociates to increase the [H⁺] in the solution. Therefore, if the amount of CO2 in a solution is increased, the [H⁺] increases (pH is lowered) and the solution becomes more acidic. It also follows that if the amount of CO2 in a solution is lowered (e.g., by removal of CO2 from the solution), the [H⁺] will decrease (pH increases) and the solution becomes more basic. The chemical reactions involved are shown below.

To detect the process of carbon fixation (CO2 reduction), you will use this pH indicator to detect changes in the CO2 level.

Materials

Fresh spinach leaves

2 glass test tubes

2 - 250 ml beakers

Phenol red solution

Permanent marker or wax pencil

Water *

Sunshine or bright light source *

Stopwatch/timer

Metric ruler

Procedure

Add 20 ml of phenol red solution to 2 glass test tubes.

With your straw , blow bubbles over the top of the solution until it turns yellow. The color change occurs when the water in the phenol red solution and the CO2 are combined forming carbonic acid . Make sure that both tubes are the same shade of yellow.

Add a small leaf of baby spinach to tube 2 only

Place the 2 test tubes into sunshine or a bright light at time for 2 hours.

Record the color every ½ hour.

Questions

What is the independent variable in this experiment?

What is the dependent variable in this experiment?

What happened to the color of the solution over time?

What is the process that is occurring to make the phenol red solution change colors?

What is the function of the following components in the process of photosynthesis (this may differ than how this compounds were used in the experiment)

CO₂:

Light:

H₂O:

O₂:

Chloroplasts:

Would you be more likely to find single nucleotide polymorphism in the protein-coding or in the noncoding dna of the human genome? Please explain, I do not understand the key.

True or false One of the most important principles governing an ecosystem is that the inputs to the ecosystem are equal to the outputs

1. What is the importance of generating isolated bacterial colonies?

2. Describe how a bacterial sample would be obtained from and inoculated into each of the following types of media.

Agar slant:

Agar plate:

Broth:

4. What is a subculture?

6. How would a subculture appear if a colony containing both S. marcescens and M. luteus was subcultured to

a slant?

7. Condensation often gathers in the bottom of agar slants. Why is it important in this exercise to limit

condensation on plates but not on slants?

8. Which separation method is not appropriate for use with cultures containing a great deal of bacterial

growth? Why is this method not a good choice for these conditions?

9. Why is agar cooled to 50°C prior to being inoculated with bacteria? What would happen if the agar were

significantly warmer or cooler when inoculated?

10. How could you identify a potential contaminant on a streak plate? A pour plate? A spread plate?

11. How would any of the the isolation techniques seen in this laboratory exercise be affected by the use of

selective medium?

1. Why was it important in this case to identify Salmonella Typhi in the feces of the restaurant worker?

Wouldn’t the discovery of any bacterium be adequate?

2. Which of the three isolation techniques in this exercise would have been least suited to the isolation of

Salmonella Typhi in this case? Why?

3. MacConkey agar is a selective medium that only allows certain types of bacteria to grow. How could

the use of MacConkey agar has simplified the isolation of Salmonella Typhi in this case?

4. Thinking through the case, other than the restaurant workers, when else was microbiological

sampling likely used?

It is illegal to use primates in product testing research; however, primates are used in biomedical and behavioral research. Can you describe any interesting research which utilizes non-human primates as subjects? Did you find this information on the web, in a journal article, through personal experience, etc.?

Diseases that occur at consistent annual rates within a country are referred to as:

Epidemic

Pandemic

Eradicated

Endemic

Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse

and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up.

-----

Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis?

5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’

3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’

a) 5’ GGAAAATTCAGATCTTAG 3’;

5’ TGGGCAATAATGTAGCGC 3’

b) 5’ GCTAAGATCTGAATTTTC 3’;

3’ ACCCGTTATTACATCGCG 5’

c) 3’ GATTCTAGACTTAAAAGGC 5’;

3’ ACCCGTTATTACATCGCG 5’

d) 5’ GCTAAGATCTGAATTTTC 3’;

5’ TGGGCAATAATGTAGCGC 3’.

Greg Wilson, a 65-year-old man, is diagnosed with pneumonia. He has a history of congestive heart failure. His physician has ordered an antibiotic for the pneumonia and he takes digoxin every day.

As the health care provider, which question would you ask first before administering his antibiotic? Why is the first dose of the antibiotic twice as much as the maintenance dose? Which variables may slow his metabolism and excretion?

Which group is the furthest from the other two, evolutionarily-speaking?

-Eukarya

-Archaea

-Bacteria

You are a researcher in a biochemistry lab which investigates a novel, globular protein production by yeast. The director of the lab asks you to produce and purify the protein. Unfortunately, you could not obtain any information about if the protein is extracellular or intracellular. Within this scope, please propose a method/methods for isolating the protein after the production process. You have a well-equipped laboratory with the equipment would require to isolate and purify. In addition describe an experiment or set of experiments to prove (or disprove) the protein is composed of more than one subunit.