Question

In: Biology

Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse...

Please explain why B is the correct answer, I know on the 5'---->3' it goes reverse

and 3'-->5' it goes forward.......I got lost after this. Please explain. Will give a thumbs up.

-----

Which of the following sets of primers could you use to amplify the target DNA sequence below, which is part of the last protein-coding exon of the gene involved in cystic fibrosis?

5’- ggctaagatctgaattttccgag … ttgggcaataatgtagcgcctt - 3’

3’- ccgattctagacttaaaaggctc … aacccgttattacatcgcggaa – 5’

a) 5’ GGAAAATTCAGATCTTAG 3’;

5’ TGGGCAATAATGTAGCGC 3’

b) 5’ GCTAAGATCTGAATTTTC 3’;

3’ ACCCGTTATTACATCGCG 5’

c) 3’ GATTCTAGACTTAAAAGGC 5’;

3’ ACCCGTTATTACATCGCG 5’

d) 5’ GCTAAGATCTGAATTTTC 3’;

5’ TGGGCAATAATGTAGCGC 3’.

Solutions

Expert Solution

Firstly want to explain that the DNA template is read in 3? to 5? direction and a new strand is synthesized in the 5? to 3? direction.

RNA polymerase uses template strand DNA strands to make a complementary RNA molecule.

The RNA produced is complementary to the template strand and is identical to nontemplate or coding strand, except in RNA, all T nucleotides are replaced with U nucleotides.

In this question, you need a forward primer and a reverse primer which is the reverse complement of 5' -> 3') that matching your input sequence.

Reverse primer anneal to the plus strand, which is oriented in the 5' ? 3' direction. It is also called as the sense or non template strand.

Reverse primer attaches to the stop codon of the complementary strand of DNA (the anti-sense strand).


Forward primer which is complement the minus strand, which is by convention oriented in the 3' ? 5' direction. It is also known as antisense or template strand.

The forward primer attaches to the start codon of the template DNA (the sense strand),

The 5' ends of both primers bind to the 3' end of each DNA strand.




Related Solutions

IMPORTANT: I know the answer is "C". However, I don't know why. Could you please explain...
IMPORTANT: I know the answer is "C". However, I don't know why. Could you please explain why? Thank you A linear total cost curve that passes through the origin implies that a.         average cost is constant and marginal cost is variable. b.         average cost is variable and marginal cost is constant.             c.         average and marginal costs are constant and equal.             d.         you need more information to answer question.
PLEASE explain why each answer of the following questions is correct, I need to understand it...
PLEASE explain why each answer of the following questions is correct, I need to understand it . 1)Economy is at its long run equilibrium. Assuming all else equal, stock market collapses and consumer sentiment level deteriorates. Which of the following is incorrect? A. In short run, output level decreases and price level decreases. B. In long run, output level is back to its long run output level. C. In short run, short run aggregate supply decrease. D. In long run,...
Please explain why the correct answer is correct A bank reconciliation reconciles the bank statement with...
Please explain why the correct answer is correct A bank reconciliation reconciles the bank statement with the company's: Correct Answer: B. Cash account in the balance sheet. A corporation received $2,000 for interest earned on a note for a loan made to an employee in the current year. How would this transaction be recorded and what type of activity would this be classified under? Selected Answer: C. Debit Accounts Receivable $2,000, credit Interest Revenue $2,000; Financing Correct Answer: A. Debit...
Which of the following statements is NOT correct? (Please explain why answer E is correct) a)corporate...
Which of the following statements is NOT correct? (Please explain why answer E is correct) a)corporate governance is the set of rules that control a company's behavior towards its directors, managers, employees, shareholders, creditors, customers, competitors, and community b) agency problem is that managers may act in their own interests and not on behalf of stockholders. c) Corporate governance is the set of rules that control a company's behavior towards its directors, managers, employees, shareholders, creditors, customers, competitors, and community....
I know the answer for A is 155 and B is 102, please show work how...
I know the answer for A is 155 and B is 102, please show work how to to get there especially after finding 13(208)- 53 (51) for A. And For b same thing please show work step by step. A) Find the multiplicative inverse of 51 (mod 208). justify your answer and leave it as number between 0 and 207. B) solve the following linear congruence. Justify your work and leave your answer as a number between 0 and 207...
If you keep giving the correct answer and didn't explain it goes to trash A committee...
If you keep giving the correct answer and didn't explain it goes to trash A committee of 3 has to be chosen randomly from a group of 40 people . there are 40 people total are from 4 different countries. 10 from each country. What is the probability that the members of the committee are all from different country? Why my answer is not correct? (4C1*10C1*3C1*10C1*2C1*10C1/ 40C3) you need to tell me what is wrong with my answer if you...
Underline all the correct answers. Explain why an answer is correct or why it is wrong....
Underline all the correct answers. Explain why an answer is correct or why it is wrong. You are supposed to select all of the correct answers (1-6) for each roman numeral (I-III) --Please justify/explain answers thoroughly-- Problem 7. If photons with energy of 1.7 eV was applied to A Si Wafer is at 300k (Eg for Si =1.12eV), the valence and conduction band are (I) 1-      Both are completely empty 2-      Both are completely filled. 3-      Both are partially empty....
Determine the correct answer and explain why it is correct. Identify why the other options are...
Determine the correct answer and explain why it is correct. Identify why the other options are not correct. One of the major roles of the TCA cycle is to generate reduced cofactors for ATP production from oxidative phosphorylation. The compound donating the net eight electrons to the cofactors is which one of the following? Pyruvate Acetyl-CoA Lactate Oxaloacetate Phosphoenolpyruvate
Determine the correct answer and explain why it is correct. Identify why the other options are...
Determine the correct answer and explain why it is correct. Identify why the other options are not correct. Which one of the following correctly describes how the acetyl-CoA is metabolized in the mitochondria? One molecule of acetyl-CoA produces two molecules of CO2, three molecules of NADH, one molecule of FAD(2H) and one molecule of ATP. All of the energy for high-energy phosphate bonds is derived from oxidative phosphorylation. NAD+ is the only electron acceptor in the cycle. Substrate-level phosphorylation generates...
Please answer this question with explanation. I will upvote your answer if it is correct and...
Please answer this question with explanation. I will upvote your answer if it is correct and clear. Thank you! You are given a positive integer n of the form n = 2h − 1, for some integer h ≥ 1. Give an example of an array of length n where the following method of building a heap step 1. Place the new key at the first free leaf step 2. The heap-order property might be violated: perform a bubble-up, uses...
ADVERTISEMENT
ADVERTISEMENT
ADVERTISEMENT